NOD/ShiLtJ-Mtv3^em1Jpd/J

Stock number: 038946
Product name: Mtv3 null
Research areas: Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Mtv3 null mice carry a CRISPR/Cas9-generated deletion of the entire Mtv3 gene as well as the adjacent noncoding RNA segment. Male and female mice exhibit type 1 diabetes (T1D) onset similar to NOD mice. This strain is useful when studying retroviral SAgs contributions to T1D pathogenesis and when studying the role of Vb3 T cells in other autoimmune diseases than affect NOD mice.

Detailed description

Mtv3 null mice carry a CRISPR/Cas9-generated deletion of the entire mammary tumor virus locus 3 (Mtv3) gene as well as the adjacent noncoding RNA segment. Mtv3 encodes an endogenous retrovirus inserted into the NOD genome at a region of Chromosome 11. MTV3 deletes the majority of VΒ3⁺ thymocytes in NOD mice. MTV3 has also been identified as the genetic element underlying insulin dependent diabetes 32 (Idd32) diabetes resistance locus in the type 1 diabetes (T1D) susceptible NOD mouse.

Mice that are homozygous for this null allele are viable and fertile.

In these mice, type 1 diabetes (T1D) development is similar to that seen in NOD mice (Stock No. 001976). Ablating Mtv3 and restoring VΒ3⁺ T-cells has no known effect on spontaneous T1D development (November 2023). This strain is useful when studying retroviral SAgs contributions to T1D pathogenesis and when studying the role of Vb3 T cells in other autoimmune diseases that NOD develop.

Development

sgRNAs (ACATTTGCTGAGGCCTCAAC and CTCCAGAACGGAGAAGATGT) were used to excise the entire mammary tumor virus locus 3 (Mtv3) gene as well as the adjacent noncoding RNA segment. Transcript BC018473-204 (ENSMUST00000156293.8) was used as reference for the exon number and guide sequences for the Lnc non-coding RNA adjacent to Mtv3. Guide RNAs and Cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from NOD/ShiLtJ mice (Stock No. 001976) with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Mtv3 null pups were identified by sequencing and PCR and further backcrossed to NOD/ShiLtJ mice for at least two generations. It is unknown if any any off-target CRISPR sites are present. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize NOD/ShiLtJ oocytes.

Allele

Symbol: Mtv3^em1Jpd
Name: endonuclease-mediated mutation 1, John Driver
MGI accession ID: MGI:7562001
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Mtv3
Marker name: mammary tumor virus locus 3
Marker synonyms: Mtv-18; Mtv-3
Chromosome: 11
Strain of origin: NOD/ShiLtJ
Molecular note: sgRNAs (ACATTTGCTGAGGCCTCAAC and CTCCAGAACGGAGAAGATGT) are used to excise the entire Mtv3 gene as well as the adjacent noncoding RNA segment. Transcript BC018473-204 (ENSMUST00000156293.8) is used as reference for the exon number and guide sequences for the Lnc non-coding RNA adjacent to Mtv3.