C57BL/6J-Pgbd5^em1Aken/J

Stock number: 038881
Product name: Pgbd5-D236A
Research areas: Cancer Research, Developmental Biology Research, Neurobiology Research

Description

Pgbd5-D236A knock-in (KI) mice harbor a CRISPR/Cas9-generated aspartate to alanine substitution (D236A) of the Pgbd5 gene, resulting in expression of a catalytically deficient PGBD5 mutant. These mice may be useful for studying the role of Pgbd5 in neuronal development and plasticity as well as genomic rearrangements and instability in various cancers.

Note that the donating laboratory has also made a Pgbd5-floxed mouse line available (Stock No. 037535).

Detailed description

PiggyBac transposable element derived 5 (Pgbd5) is one of the most highly conserved vertebrate transposases which mediates cut-and-paste DNA transposition of piggyBac transposons. PGBD5 is expressed during embryogenesis and neurogenesis, but also found in increased levels in many solid tumors such as medulloblastomas, neuroblastomas, Ewing sarcomas, desmoplastic small round cell tumors, and rhabdomyosarcomas. These Pgbd5-D236A knock-in (KI) mice harbor a CRISPR/Cas9-generated aspartate to alanine substitution in exon 2 (D236A) of the Pgbd5 gene; this mutation results in a catalytically inactive protein.

Heterozygous Pgbd5-D236A KI mice are viable and fertile; however, ~30% of heterozygous mice may display seizure activity upon hypoxia stressors or anxiety-inducing stressors. While homozygous Pgbd5-D236A KI mice are viable, it is not known if these mice are fertile due to seizure phenotype. The donating laboratory has indicated that while homozygous Pgbd5-D236A KI mice exhibit normal levels of PGBD5 protein, compared to wildtype littermates, their neurological phenotype mimics that of a Pgbd5-deficient (knock-out) mutant. Pgbd5-D236A KI homozygotes are significantly smaller in body size/weight and demonstrate tonic-clonic seizures and learning deficits by 12 weeks of age. These Pgbd5-D236A KI mice may be useful for studying the role of Pgbd5 in the developing nervous system and tumorigenesis in multiple cancers.

Note that based on sequencing analysis performed by The Jackson Laboratory, utilizing the Ensembl canonical transcript (Transcript: Pgbd5-203, ENSMUST00000140012.8) as reference, the amino acid substitution location has been updated to D236A.

Development

The Pgbd5-D236A knock-in (KI) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs [crRNA #1 (AGCCACTCTGCAGGGAGTCG), crRNA #2 (ACATGAACCCCTGATTGACG) and tracrRNA] were used to target exon 2 of the piggyBac transposable element derived 5 (Pgbd5) gene on chromosome 8, resulting in an amino acid substitution of an aspartate to an alanine (D236A). The guide RNAs, donor sequence and Cas9 nuclease were introduced into C57BL/6J zygotes and transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and sequencing. Two founder lines were generated, line 73 and line 107. This Pgbd5-D236A KI line was established using progeny from founder line 107. The resulting heterozygous Pgbd5-D236A KI mice were bred to C57BL/6J mice for at least 5 generations to reduce off-target CRISPR events. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Note that based on sequencing analysis performed by The Jackson Laboratory, utilizing the Ensembl canonical transcript (Transcript: Pgbd5-203, ENSMUST00000140012.8) as reference, the amino acid substitution location has been updated to D236A.

Allele

Symbol: Pgbd5^em1Aken
Name: endonuclease-mediated mutation 1, Alex Kentsis
MGI accession ID: MGI:7469447
Generation method: Endonuclease-mediated
Attributes: Not Applicable
Synonyms: Pgbd5^D262A; Pgbd5^ki
Marker symbol: Pgbd5
Marker name: piggyBac transposable element derived 5
Marker synonyms: 2900019M05Rik; NEDSHS
Chromosome: 8
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 endonuclease-mediated genome editing is used to create an aspartate to alanine substitution at codon 262 in exon 2. The mutation is changes the aspartate residue needed for cellular DNA activity to an inactive alanine. The crRNA and tracrRNA sequences are as follows; crRNA #1 for D/A on Exon 2, sequence (AGCCACTCTGCAGGGAGTCG), crRNA #2 for D/A on Exon 3, sequence (ACATGAACCCCTGATTGACG); tracrRNA.