C57BL/6J-Rr612^em1Aben/J

Stock number: 038855
Product name: Gata3 +674/762^Δ
Research areas: Immunology, Inflammation and Autoimmunity Research

Description

Gata3 +674/762^Δ mice have a deletion of an enhancer region spanning from +674 kb to +762 kb, downstream of the Gata3 gene. These mice may be useful when studying T cell and innate lymphoid cell development and differentiation.

Detailed description

The GATA binding protein 3 (Gata3) gene encodes a zinc-finger transcription factor essential in T cell and innate lymphoid cell development and differentiation. This Gata3 +674/762^Δ mouse model carries an 88kb deletion of a Gata3 enhancer region spanning from +674kb to +762kb downstream of the Gata3 gene. This enhancer region functions as a type 2-specific Gata3 enhancer, which is highly selective for group 2 innate lymphoid cells (ILC2s) with minimal impact on type 2 helper T (Th2) cell differentiation and function. Homozygous Gata3 +674/762^Δ mice are viable and fertile but do display an impairment in ILC2 differentiation and function under normal conditions and during type 2 inflammation.

Development

The Gata3 +674/762^Δ allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide crRNAs [CACAAGTTATAATGAGCGTG and TACTACACACGTGTAAGTAC] were used to target a distal regulatory region of the GATA binding protein 3 (Gata3) gene on chromosome 2 and remove an 88 kb region spanning from +674 kb to +762 kb. Gata3 transcript Gata3-201 (ENSMUST00000102976.4) was used as reference for the exon number and guide sequences. The guide RNAs, donor sequence and Cas9 nuclease were introduced into C57BL/6J zygotes and transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and sequencing. The resulting heterozygous Gata3 +674/762^Δ mice were bred to C57BL/6J mice for at least 4 generations by the donating laboratory to reduce off-target CRISPR events (see SNP note below). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

In 2025, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Two of the 43 markers throughout the genome were segregating with an unknown source.

Allele

Symbol: Rr612^em1Aben
Name: endonuclease-mediated mutation 1, Albert Bendelac
MGI accession ID: MGI:8164018
Generation method: Endonuclease-mediated
Attributes: Modified regulatory region
Synonyms: Gata3 +674/762 delta
Marker symbol: Rr612
Marker name: regulatory region 612
Marker synonyms: Gata3 +674/762
Chromosome: 2
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing. Guide crRNAs [CACAAGTTATAATGAGCGTG and TACTACACACGTGTAAGTAC] were used to target a distal regulatory region Rr612 of the GATA binding protein 3 (Gata3) gene on chromosome 2 and remove an 88 kb region spanning from +674 kb to +762 kb.