B6.Cg-Sdk1^{em1(cre/GFP)Jrs}/KrishJ

Stock number: 038835
Product name: Sdk1::CreGFP
Research areas: Developmental Biology Research, Neurobiology Research, Research Tools, Sensorineural Research

Description

CRISPR/Cas9 generated Sdk1::CreGFP knock-in/knock-out mice have a cre/GFP fusion gene inserted at the translation start site of the Sdk1 gene. This strain is useful for studying interneurons and retinal ganglion cell synapses and their role in visual function.

Detailed description

CRISPR/Cas9 generated Sdk1::CreGFP knock-in/knock-out mice have a cre/GFP fusion gene inserted at the translation start site of the sidekick cell adhesion molecule 1 (Sdk1) gene. SDK1 is a member of the immunoglobulin superfamily that acts as an adhesion molecule that promotes synaptic connectivity in interneurons and retinal ganglion cells (RGCs). Homozygous mice are viable and fertile. When these mice are bred with mice containing loxP-flanked sequences, cre-mediated recombination will result in deletion of the floxed sequences in cre-expressing cells as well as expression of GFP. In these mice, Cre and GFP are localized to the nuclei of Sdk1-expressing cells including subsets of mouse retinal neurons as detected by immunohistochemistry and direct fluorescence.

Of note, Sdk1^ce/ce knock-in/knock-out mice have cre/ERT2 replacing exons 1-2, including the ATG start site of Sdk1, and are available as Stock No. 038840.

Development

Plasmids encoding a guide RNAs (CGGCATGGCCCGCGCCCGGC and GGTGGCGGGCGGCGGAGTCG) were designed to insert a cre/GFP fusion gene (containing a cre recombinase fused to a green fluorescent protein sequence) at the translation start site of the sidekick cell adhesion molecule 1 (Sdk1) gene. sgRNA and the cas9 nuclease were introduced into the cytoplasm of C57BL/6-derived zygotes with well recognized pronuclei. Injected embryos were transferred to pseudopregnant females and resulting Sdk1::CreGFP mice were identified by PCR and sequencing. Founder mice were further bred to C57BL/6J mice for at least 8 generations by the donating laboratory to develop the colony. No off-target CRISPR changes are present. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664). In 2024, genotyping at The Jackson Laboratory identified the presence of an ampicillin resistance gene (AMP) that is segregating with Sdk1::CreGFP allele.

Allele

Symbol: Sdk1^{em1(cre/GFP)Jrs}
Name: endonuclease-mediated mutation 1, Joshua R Sanes
MGI accession ID: MGI:7439467
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing; Reporter
Synonyms: Sdk1::CreGFP; Sdk1^CG
Marker symbol: Sdk1
Marker name: sidekick cell adhesion molecule 1
Marker synonyms: 6720466O15Rik; RGD1560686
Chromosome: 5
Strain of origin: Not Specified
Molecular note: Using CRISPR/Cas9, a Cre-GFP sequence was inserted at the translational start site of the Sdk1 gene.