STOCK Tbx2^em3Zyliu/J

Stock number: 038820
Product name: Tbx2^flox
Research areas: Cell Biology Research, Neurobiology Research, Research Tools, Sensorineural Research

Description

Tbx2^flox/flox mice carry a CRISPR/Cas9 generated mutation that results in loxP sites flanking exon 2 of the T-box 2 (Tbx2) gene. These mice may be useful when studying the role of TBX2 in the transdifferentiation of mature inner hair cells (IHCs) into outer hair cells (OHCs) in studies of deafness.

Detailed description

Tbx2^flox/flox mice carry a CRISPR/Cas9 generated mutation that results in loxP sites flanking exon 2 of the T-box 2 (Tbx2) gene. Tbx2 encodes a transcription factor that plays a role in maintaining the cell fate of differentiating and mature inner hair cells (IHCs) by preventing these cells from transdifferentiating into outer hair cells (OHCs). Mice that are homozygous for this allele are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exon 2 removed in the cre-expressing tissues of the offspring.

When Tbx2^flox/flox floxed mice are bred to Slc17a8^iCreER mice (Stock No. 034736), with tamoxifen-inducible Cre recombinase expression in IHCs, resulting Tbx2 cko mice contain IHCs that transdifferentiate into OHCs by P7 after tamoxifen administration at P2 and P3. These OHCs that underwent cell-fate change from IHCs (abbreviated as iOHCs) are Prestin+ (an OHC marker) and have decreased or no vGlut3 expression (an IHC marker).

Development

Plasmids encoding a guide RNA (ATGTCATGTCATTGTCGGGA and AGGGGCCCCCACAGTCGAGT) were designed to insert loxP sites flanking exon 2 of the T-box 2 (Tbx2) gene. sgRNA and the cas9 nuclease were introduced into the cytoplasm of hybrid C57BL/6 and DBA/2J zygotes with well recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting Tbx2^flox F0 mice were screened by tail PCR. The F0 mice, with potential correct targeting, were further bred to C57BL/6J mice for one generation for germ line transmission to develop the germ line stable colony. These F1 mice were further subject to PCR and Southern blot. Mice with no random insertion of the gene targeting vector, were chosen for colony expansion. Mice were further bred to mice containing the Atoh1^3*HA-P2A-Cre allele found in Stock No. 037103. Subsequently, these mice were bred to C57BL/6J mice (Stock No. 000664) for at least 5 generations by the donating laboratory (see SNP note below) and the Atoh1^3*HA-P2A-Cre allele was removed. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Most of the 43 markers throughout the genome were segregating with DBA/2J. Also, two markers on Chromosome 9 and 17 are segregating with an unknown source. This suggests an incomplete backcross.

Allele

Symbol: Tbx2^em3Zyliu
Name: endonuclease-mediated mutation 2, Zhiyong Liu
MGI accession ID: MGI:7495855
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Tbx2^flox
Marker symbol: Tbx2
Marker name: T-box 2
Marker synonyms: VETD
Chromosome: 11
Strain of origin: Not Specified
Molecular note: CRISPR/cas9 genome editing is used to insert loxP sites flanking exon 2.