STOCK Gt(ROSA)26Sor^{em3(CAG-Insm1,-tdTomato)Zyliu}/J

Stock number: 038819
Product name: Rosa26^Insm1
Research areas: Cell Biology Research, Neurobiology Research, Research Tools, Sensorineural Research

Description

CRISPR/Cas9 generated Rosa26^Insm1 mice contain a Cre-inducible 3xHA C-terminal tagged Insm1 gene fused to a P2A-tdTomato sequence inserted into the Gt(ROSA)26Sor locus. These mice are useful for lineage tracing, cell sorting, and gene manipulation of multiple cell types including cochlear hair cells (HCs).

Detailed description

CRISPR/Cas9 generated Rosa26^Insm1 mice contain a Cre-inducible 3xHA C-terminal tagged Insm1 gene fused to a P2A-tdTomato sequence, all inserted into the Gt(ROSA)26Sor locus. Insm1 is an intronless gene that encodes a protein containing both a zinc finger DNA-binding domain and a putative prohormone domain. It plays a role in neurogenesis and neuroendocrine cell differentiation during development. It has also been associated with inner hair cell differentiation and has been noted as a marker for neuroendocrine differentiation of human lung tumors. Homozygous mice are viable and fertile. In the absence of cre, Insm1 and tdTomato expression is prevented by the STOP cassette. After removal of the loxP-flanked STOP cassette via cre-mediated recombination, Insm1 and tdTomato are initially translated together from the same polycistronic mRNA, and are subsequently separated by the 2A peptide. Once triggered, the expression of Insm1 and tdTomato is permanent, which enables genetic fate-mapping analysis at single-cell resolution in cre-expressing tissues of the offspring.

Development

Plasmids encoding a guide RNA (ACTCCAGTCTTTCTAGAAGA) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette and a 3xHA (hemaglutinin) C-terminal tagged insulinoma-associated 1 (Insm1) gene into the Gt(ROSA)26Sor locus. A viral 2A oligopeptide (P2A) self cleaving peptide, that mediates ribosomal skipping, fused to a red fluorescent protein sequence (tdTomato) was inserted downstream. sgRNA and the cas9 nuclease were introduced into the cytoplasm of hybrid C57BL/6 and DBA/2J zygotes with well recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Resulting Rosa26^Insm1/+ F0 mice were screened by tail PCR. The F0 mice, with potential correct targeting, were further bred to C57BL/6J mice for one generation for germ line transmission to develop the germ line stable colony. These F1 mice were further subject to PCR and Southern blot. Mice with no random insertion of the gene targeting vector were chosen for colony expansion. Mice were further bred to mice containing a cre allele and mice containing the Ikzf2*3xV5-P2A-tdTomato allele found in Stock No. 038463. Subsequently, these mice were bred to C57BL/6J mice (Stock No. 000664) for at least 5 generations by the donating laboratory (see SNP note below) and the cre and Ikzf2*3xV5-P2A-tdTomato alleles were removed. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Most of the 43 markers throughout the genome were segregating with DBA/2J. Also, one marker on Chromosome 17 is segregating with an unknown source. This suggests an incomplete backcross.

Allele

Symbol: Gt(ROSA)26Sor^{em3(CAG-Insm1,-tdTomato)Zyliu}
Name: endonuclease-mediated mutation 3, Zhiyong Liu
MGI accession ID: MGI:7505567
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter; Inserted expressed sequence; Epitope tag
Synonyms: Rosa26^Insm1; Rosa26-CAG-Loxp-stop-Loxp-Insm1*3×HA-P2A-tdTomato
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: (C57BL/6 x DBA/2J)F1
Molecular note: Plasmids encoding a guide RNA (ACTCCAGTCTTTCTAGAAGA) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette and a 3xHA (hemaglutinin) C-terminal tagged Insm1 gene into the Gt(ROSA)26Sor locus. A viral 2A oligopeptide (T2A) self cleaving peptide, that mediates ribosomal skipping, fused to a red fluorescent protein sequence (tdTomato) was inserted downstream.