STOCK Gt(ROSA)26Sor^{em2(CAG-Gf1i,-Atoh1/EGFP)Akg}/J

Stock number: 038584
Product name: ROSA-GA
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

ROSA-GA knock-in mice have a CRISPR/Cas9 generated insertion of a floxed STOP cassette, followed by an Gfi1 sequence and a Atoh1 sequence fused to an enhanced green fluorescent protein (eGFP), into the endogenous Gt(ROSA)26Sor locus. When crossed with a Cre recombinase expressing strain, removal of the floxed STOP cassette will result in co-expression of the transcription factors GFI1 and ATOH1/eGFP in cre-expressing tissues. These mice may be useful for evaluating overexpression of GFI1 and ATOH1 in neuronal and auditory hair cell development, differentiation and regeneration.

Detailed description

Hair cells (HCs) are the sensory cells of the inner ear that are necessary for hearing and balance. Studies of HC development have demonstrated that progression of precursor cells to HCs relies on the transcription factors atonal bHLH transcription factor 1 (ATOH1), POU domain, class 4, transcription factor 3 (POU4F3) and growth factor independent 1 transcription repressor (GFI1). These ROSA-GA mice harbor a floxed STOP cassette followed by an Gfi1 sequence and a Atoh1 sequence fused to an enhanced green fluorescent protein (eGFP), inserted into the endogenous Gt(ROSA)26Sor locus. The Gfi1 and Atoh1/eGFP sequences are separated by a GSG-P2A peptide sequence. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will express both Gfi1 and Atoh1/eGFP fusion protein in cre-expressing tissues.

Homozygous ROSA-GA mice are viable and fertile with no overt phenotype. The eGFP fluorescent signal is detectable by immunostaining. The donating laboratory bred these ROSA-GA mice to STOCK Tg(Sox9-cre/ERT2)1Msan/J transgenic mice (Stock No. 018829) and confirmed the pattern of recombination in greater epithelial ridge (GER) and supporting cells of the neonatal mouse organ of Corti corresponds to the normal expression of SOX9 protein. These ROSA-GA mice, along with ROSA-A (Stock No. 038583) and ROSA-GAP (Stock No. 038585) mice, may be useful in studying auditory hair cell development and differentiation.

Development

The ROSA-GA targeting vector was designed using a modified Ai3 (Gt(ROSA)26So^{tm3(CAG-EYFP)Hze}) vector where the eGFP sequence was replaced with coding regions for growth factor independent 1 transcription repressor (Gfi1) and atonal bHLH transcription factor 1 (Atoh1) fused to an enhanced green fluorescent protein (eGFP). Specifically, the targeting vector includes (from 5' to 3') a splice acceptor, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a loxP-flanked STOP (with stop codons in all 3 reading frames and a triple polyA signal) cassette, Gfi1 sequence, a GSG oligopeptide linker-P2A peptide sequence, Atoh1/eGFP fusion gene, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), polyA sequence, followed by an attB/attP-flanked PGK-neo-PGKpA cassette. This entire construct was inserted between exons 1 and 2 of the Gt(ROSA)26Sor locus via electroporation with CRISPR-assisted targeting vectors (gRNA ACTGGAGTTGCAGATCACGA GGG) in 129S7/SvEvBrd-Hprt^b-m2-derived AB2.2 embryonic stem (ES) cells. Correctly targeted ES cells were selected, and chimeric mice were bred to C57BL/6J mice. ROSA-GA mice were then maintained on a mixed background (C57BL/6J, 129S and ICR) by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Gt(ROSA)26Sor^{em2(CAG-Gf1i,-Atoh1/EGFP)Akg}
Name: endonuclease-mediated mutation 2, Andrew K Groves
MGI accession ID: MGI:7522007
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter; Inserted expressed sequence
Synonyms: Rosa-GA
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: 129S7/SvEvBrd-Hprt1^b-m2
Molecular note: The targeting vector is designed using a modified Ai3 (Gt(ROSA)26So(tm3(CAG-EYFP)Hze)) vector where the eGFP sequence was replaced with coding regions for growth factor independent 1 transcription repressor (Gfi1) and atonal bHLH transcription factor 1 (Atoh1) fused to an enhanced green fluorescent protein (eGFP). Specifically, the targeting vector includes (from 5' to 3') a splice acceptor, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a loxP-flanked STOP (with stop codons in all 3 reading frames and a triple polyA signal) cassette, Gfi1 sequence, a GSG oligopeptide linker-P2A peptide sequence, Atoh1/eGFP fusion gene, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), polyA sequence, followed by an attB/attP-flanked PGK-neo-PGKpA cassette. This entire construct was inserted between exons 1 and 2 of the Gt(ROSA)26Sor locus.