B6(129)-Creb5^em1Abl/J

Stock number: 038581
Product name: Creb5^flox9
Research areas: Cell Biology Research, Internal/Organ Research, Research Tools

Description

Creb5^flox9/flox9 mice have loxP sites flanking exon 9 of the cAMP responsive element binding protein 5 (Creb5) gene. These mice may be useful when studying synovial joint formation and the development of articular chondrocytes.

Detailed description

Creb5^flox9/flox9 mice carry a CRISPR/Cas9 generated mutation that results in loxP sites flanking exon 9 of the cAMP responsive element binding protein 5 (Creb5) gene. Creb5 encodes a transcription factor involved in the expression of signaling molecules that both direct the formation of synovial joints and guide perichondrial tissue to form articular cartilage instead of bone in part by inducing expression of molecules that block a Wnt5a autoregulatory loop in the perichondrium. Mice that are homozygous for this Creb5^flox9/flox9 floxed allele are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exon 9 removed in the cre-expressing tissues of the offspring. Exon 9 encodes both the basic region and 3 out of 5 leucines of the Creb5 bZIP domain, which encodes the DNA binding domain of Creb5 and is critically required for both dimerization and DNA interaction of bZIP transcription factors. Mice with homozygous germline deletion of Creb5 (Creb5^Δ9/Δ9) are perinatal lethal.

Development

Guide RNAs (cccccactaggattctccaaatg and cctcatctataattagggaccaa) were designed to insert loxP sites flanking exon 9 of the cAMP responsive element binding protein 5 (Creb5) gene (ENSEMBL Transcript: ENSMUST00000203487.3 Creb5-202). gRNAs, a 1369-base single strand DNA donor, and Cas9 protein were injected into the cytoplasm of C57BL/6-derived embryos with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females and resulting Creb5^flox9 pups were identified by PCR and sequencing. Founder mice were further bred to C57BL/6J mice (Stock No. 000664) for 3 generations by the donating laboratory, and subsequently they were bred to CAG-Sun1/sfGFP mice (Stock No. 030952). It is unknown if any off-target CRISPR changes are present. The CAG-Sun1/sfGFP allele was bred out of the mice sent to The Jackson Laboratory. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Creb5^em1Abl
Name: endonuclease-mediated mutation 1, Andrew Lassar
MGI accession ID: MGI:7511680
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Creb5^flox9
Marker symbol: Creb5
Marker name: cAMP responsive element binding protein 5
Marker synonyms: 9430076C15Rik; CREB-5; CREBPA; CRE-BPA; D430026C09Rik; RGD1566107
Chromosome: 6
Strain of origin: C57BL/6
Molecular note: Guide RNAs (cccccactaggattctccaaatg and cctcatctataattagggaccaa) are designed to insert loxP sites flanking exon 9 of the gene (ENSEMBL Transcript: ENSMUST00000203487.3 Creb5-202).