C57BL/6-Sall1^em1Glass/J

Stock number: 038565
Product name: Sall1 EKO

Research areas: Immunology, Inflammation and Autoimmunity Research, Neurobiology Research, Research Tools

Description

Sall1 EKO (enhancer knock-out) mice have a 13 kb deletion in the super enhancer (SE) region of the Sall1 (spalt like transcription factor 1) locus resulting in a loss of Sall1 expression specifically in microglia. This strain maybe useful in studies examining microglia identity and function.
See strain Development section for information regarding Cdh23⁺ vs. Cdh23^ahl and Crb1⁺ vs. Crb1^rd8.

Detailed description

The spalt like transcription factor 1 (Sall1) gene is a zinc finger transcription factor involved in the regulation of organogenesis and microglial identity. Sall1 functions to discriminate microglia from other tissue macrophages, as well as certain mesenchymal cells and non-immune CNS cells. Expression of Sall1 in microglia is regulated by a microglia-specific super enhancer (SE) through SMAD4 binding. Germline deletion of Sall1 results in perinatal lethality due to severe kidney defects.

The Sall1 EKO allele has a 13 kb deletion in the super enhancer region. The deletion results in a loss of Sall1 expression in microglia in a dose dependent fashion. Heterozygous mice have a 50% reduction of Sall1 mRNA and homozygotes have a complete loss of Sall1 mRNA. Microglia isolated from Sall1 EKO homozygous mice have a decreased surface area, increased soma size, and decreased density in the prefrontal cortex, hippocampus and striatum. Mice homozygous for the mutation are viable and fertile.

Development

CRISPR/Cas9 endonuclease-mediated genome editing was used to delete a region spanning 13 kb of the Sall1 microglia-specific super enhancer (SE) on chromosome 8. sgRNA (protospacers: GAATGACCCTGGCAATCATG, TCCATAAG ATAGCTTAGGGA, CTTGACAG ACATTACACAGG, CTAGAATCGGCTTTGGTGCT) and cas9 endonuclease were introduced into C57BL/6J-derived one cell stage zygotes. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. The deletion was confirmed by sequencing and PCR. Mice were backcrossed to C57BL/6J for at least three generations by the donating laboratory (see SNP note below). Upon arrival at the The Jackson Laboratory Repository in 2023, sperm was cryopreserved.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. One of the 43 markers on Chromosome 10 [~60 Mbp] was heterozygous for C57BL/6-allele type and 129S-allele type; this marker lies within the Cdh23 locus and differentiates between the age related hearing loss mutant allele (Cdh23^ahl) normally present for C57BL/6 mice and the Cdh23 functional allele (Cdh23⁺) normally found for 129S. Also, 2 of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, including the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. Taken together, these data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background and were heterozygous for Cdh23^+/ahl.
Additional note: If cryorecovering from the 2023 frozen sperm using C57BL/6J inbred oocytes, the resulting live mice may be segregating for Cdh23^ahl vs. Cdh23⁺, as well as Crb1⁺ vs. Crb1^rd8.

Allele

Symbol: Sall1^em1Glass
Name: endonuclease-mediated mutation 1, Christopher K Glass
MGI accession ID: MGI:7509096
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: EKO
Marker symbol: Sall1
Marker name: spalt like transcription factor 1
Marker synonyms: HEL-S-89; HSAL1; Msal-3; Sal-1; TBS; ZNF794
Chromosome: 8
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 endonuclease-mediated genome editing used sgRNA (protospacers: GAATGACCCTGGCAATCATG, TCCATAAG ATAGCTTAGGGA, CTTGACAG ACATTACACAGG, CTAGAATCGGCTTTGGTGCT) to delete a region spanning 13 kb.