C57BL/6J-Gata3^em1Aben/J

Stock number: 038496
Product name: Gata3^Citrine
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Gata3^Citrine knock-in mice carry a citrine fluorescent reporter inserted into the Gata3 (GATA binding protein 3) locus, while retaining endogenous Gata3 expression. This strain may be useful as a reporter for Gata3 expression in the T cell lineage and subsets of innate lymphoid cells (ILCs).

Detailed description

The GATA binding protein 3 (Gata3) gene encodes a zinc-finger transcription factor essential in T cell and innate lymphoid cell development and differentiation, and in long-term hematopoietic stem cell self-renewal. Gata3^Citrine knock-in mice carry a Citrine reporter inserted into the 3' UTR of the Gata3 locus. The insertion does not affect GATA3 expression or T cell lymphopoiesis. Mice homozygous for the mutation are viable and fertile. Citrine expression mimics endogenous Gata3 expression, with highest expression noted in type 2 innate lymphoid cells (ILC2) in bone marrow, as well as in lung and small intestine ILC2 populations. Lower expression was measured in T cells and other ILCs. The citrine fluorescence can be visualized using flow cytometry. This strain may be useful as a tool for tracking innate lymphoid cell development and function.

Development

The Gata3^Citrine allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A guide crRNA [GGAGGAACTCTTCGCACACT] was used to insert an internal ribosomal entry site (IRES)/citrine yellow fluorescent sequence into the 3' UTR of the GATA binding protein 3 (Gata3) gene on Chromosome 2. Gata3 transcript Gata3-201 (ENSMUST00000102976.4) was used as reference for the exon number and guide sequences. The guide RNAs, donor sequence and Cas9 nuclease were introduced into C57BL/6J zygotes and transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and sequencing. The resulting heterozygous Gata3^Citrine mice were bred to C57BL/6J mice for at least 4 generations to reduce off-target CRISPR events. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Gata3^em1Aben
Name: endonuclease-mediated mutation 1, Albert Bendelac
MGI accession ID: MGI:7518200
Generation method: Endonuclease-mediated
Attributes: Reporter
Synonyms: Gata3^Citrine
Marker symbol: Gata3
Marker name: GATA binding protein 3
Marker synonyms: Gata-3; HDR; HDRS; jal
Chromosome: 2
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing used a guide crRNA [GGAGGAACTCTTCGCACACT] to insert an internal ribosomal entry site (IRES)/citrine yellow fluorescent sequence into the 3' UTR of the gene. Gata3 transcript Gata3-201 (ENSMUST00000102976.4) was used as reference for for the exon number and guide sequences