C57BL/6J-Atoh1^em2Zyliu/J

Stock number: 038462
Product name: Atoh1*3xV5-P2A-tdTomato
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

Atoh1-3*V5-P2A-Tdtomato mice have a CRISPR/Cas9-generated 3xV5 epitope tag and P2A-tdTomato cassette inserted into the C terminus of the atonal bHLH transcription factor 1 (Atoh1) gene. These mice are useful for visualizing inner hair cells (IHCs) and outer hair cells (OHCs) of the organ of Corti (OC) and as a tool for sorting pure neonatal cochlear HCs.

Detailed description

Atoh1-3*V5-P2A-Tdtomato mice have a CRISPR/Cas9-generated 3xV5 epitope tag and P2A-tdTomato cassette inserted into the C terminus of the atonal bHLH transcription factor 1 (Atoh1) gene. Insertion of this reporter cassette does not affect endogenous Atoh1 gene expression. Atoh1 encodes a transcription factor that plays a role in the differentiation of subsets of neural cells, such as cochlear hair cells (HCs), the dorsal spinal cord, brainstem, cerebellum, and intestinal secretory cells. In these mice, tdTomato is evident in cochlear inner hair cells (IHCs) and outer hair cells (OHCs) of the organ of Corti (OC) in all turns at P1 but not in any cochlear supporting cells (SCs), which include Pillar cells (PCs), Deiters’ cells (DCs), and Hensen’s cells (Hens).

tdTomato expression in these mice is visible by immunohistochemistry and FACS. Homozygous mice are viable and fertile.

Development

Plasmids encoding a sgRNA (5’-AATGCCCTTCCTAGCGCGCG-3’) were designed to fuse a 3xV5 epitope tag and a P2A self-cleaving peptide sequence (P2A)-tdTomato cassette to the C terminus of the atonal bHLH transcription factor 1 (Atoh1) gene (Atoh1-ENSMUSG00000073043). sgRNA, cas9 mRNA, and donor DNA were introduced into the cytoplasm of C57BL/6J-derived zygotes with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females and pups were identified by PCR. These Atoh1-3*V5-P2A-Tdtomato mice were further bred to C57BL/6J mice (Stock No. 000664) for at least 5 generations by the donating laboratory to develop the colony. Southern-blot analysis showed that there were no random insertions of donor DNA in the genome. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Atoh1^em2Zyliu
Name: endonuclease-mediated mutation 2, Zhiyong Liu
MGI accession ID: MGI:7446983
Generation method: Endonuclease-mediated
Attributes: Reporter; Epitope tag
Synonyms: Atoh1^em1Zyliu; Atoh1-3*V5-P2A-Tdtomato; Atoh1-Tdtomato KI
Marker symbol: Atoh1
Marker name: atonal bHLH transcription factor 1
Marker synonyms: ATH1; bHLHa14; DFNA89; HATH1; Math1; MATH-1; RGD1565171
Chromosome: 6
Strain of origin: C57BL/6
Molecular note: The gene was targeted with an sgRNA (targeting CGCGCGCTAGGAAGGGCATT) and a double strand DNA template using CRISPR/Cas9 technology to insert the following immediately upstream of the stop codon in the single-exon gene: three copies of sequence coding for a V5 epitope tag, sequence coding for the P2A self-cleaving peptide and the tdTomato fluorescent reporter gene. This allele will express both the endogenous gene, with C-terminal V5 tags, and the reporter gene.