C57BL/6-Nnt^em1Asuh/J

Stock number: 038374
Product name: 6N^ΔNnt8-12
Strain synonyms: C57BL/6NJ^ΔNnt8-12
Research areas: Cell Biology Research, Metabolism Research

Description

6N^ΔNnt8-12 knock-out (KO) mice contain a CRISPR/Cas9 generated deletion of exons8-12 of the nicotinamide nucleotide transhydrogenase (Nnt) gene on a C57BL/6NJ genetic background. This strain may be useful for studying the role of Nnt in reduction/oxidation-dependent processes and mitochondrial dysfunction.

Detailed description

Nicotinamide nucleotide transhydrogenase (NNT) is a mitochondrial transmembrane protein that catalyzes the conversion of NADH to NADPH. Under conditions of oxidative stress NADH will be converted to NADPH, allowing for detoxification of reactive oxygen species (ROS) to maintain efficient ATP synthesis. Mutations of Nnt may affect mitochondrial function and result in increased oxidative stress. Defects in mitochondrial function have been implicated in multiple diseases, from metabolic, cardiovascular to neuromuscular and neurodegenerative disorders. These 6N^ΔNnt8-12 knock-out (KO) mice carry a CRISPR/Cas9-generated Nnt mutation resulting in the loss of functional NNT protein on a C57BL/6NJ (Stock No. 005304) background.

Homozygous 6N^ΔNnt8-12 mice are viable and fertile with no overt phenotype. However, the donating laboratory demonstrated that these mice showed increased sensitivity to chikungunya virus-induced arthritis compared to wild-type C57BL/6NJ mice; suggesting that NNT may affect anti-inflammatory responses and pathways. These mice may be useful for studying the role of Nnt in mitochondrial dysfunction.

Development

The 6N^ΔNnt8-12 allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (CATGCCCCGTCTGCAATTTG and CAGTTACCTTGGACCCACTA) were used to target exons 8-12 of the nicotinamide nucleotide transhydrogenase (Nnt) gene on chromosome 13. MGP_C57BL6NJ_G0021355 was used as reference for the exon number and guide sequences. The sgRNAs, ssDNA (mm10) and the Cas9 nuclease mRNA were introduced into the cytoplasm of C57BL/6NJ (Stock No. 005304) zygotes with well recognized pronuclei. Correctly targeted pups were identified by PCR and Sanger sequencing. The donating laboratory backcrossed the 6N^ΔNnt8-12 to C57BL/6NJ for 2 generations to reduce off-target events (see SNP note below). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. All 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Nnt^em1Asuh
Name: endonuclease-mediated mutation 1, Andreas Suhrbier
MGI accession ID: MGI:6885566
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: C57BL/6N^deltaNnt8-12
Marker symbol: Nnt
Marker name: nicotinamide nucleotide transhydrogenase
Marker synonyms: 4930423F13Rik; GCCD4
Chromosome: 13
Strain of origin: C57BL/6N
Molecular note: CRISPR-targeting deleted 19,358 bp including exons 8 through 12 of 22 exons (mm10). This allele mimics the deletion found in C57BL/6J mice.