C57BL/6J-Txnip^em1Ngwu/J

Stock number: 038350
Product name: NTX
Strain synonyms: Txnip-HAHA KI
Research areas: Cardiovascular Research, Diabetes and Obesity Research, Metabolism Research, Research Tools

Description

NTX mice express a CRISPR-generated N-terminal double HA-tagged protein under direction of the endogenous thioredoxin interacting protein (Txnip) promoter. These mice may be useful for evaluating TXNIP localization patterns and function in glucose homeostasis, adipogenesis and energy metabolism.

Detailed description

Thioredoxin interacting protein (encoded by Txnip) is a critical regulator of metabolic homeostasis through controlling insulin release from pancreatic β-cells, glucose production from liver and glucose uptake from peripheral tissues like muscle and adipose. TXNIP may also play a regulatory role in immunity and a pathophysiological role in cardiovascular and neurodegenerative diseases. Upregulation of TXNIP has been associated with diabetes whereas ablation of TXNIP results in protection from diabetes onset in mice.

NTX knock-in mice express an N-terminal double HA-tagged thioredoxin interacting protein directed by the endogenous promoter. Homozygous NTX mice are viable and fertile with no overt phenotype. The donating laboratory indicates that the amount of TXNIP is slightly increased in the homozygous knock-in mice across multiple tissues compared to wildtype mice. However, there were no significant differences in body weight, lean mass, fat mass, fasting blood glucose, free fatty acid or triglyceride levels compared to wildtype controls. Homozygous NTX mice also demonstrated similar glucose and insulin responses, as compared to wildtype controls, after an oral glucose tolerance test (oGTT). These mice may be useful for evaluating the expression patterns and regulatory function of Txnip in metabolic homeostasis and energy expenditure processes.

Development

The NTX knock-in allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A crRNA/tracrRNA duplex gRNA (crRNA: GAACCCACUCGGCUCAAUCAGUUUUAGAGCUAUGCU, universal tracer RNA: AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU) was designed to insert an N-terminal double HA tag immediately downstream of the start codon of the thioredoxin interacting protein (Txnip) locus. The crRNA/tracrRNA, donor sequence and the Cas9 nuclease protein were introduced into the pronuclei of fertilized eggs from C57BL/6J mice. Correctly targeted pups were identified by PCR and Sanger sequencing. The resulting NTX knock-in mice were bred to C57BL/6J mice for at least 10 generations to reduce off-target events. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Donor template used to generate the NTX knock-in allele: CTGCCGTACACCTTCTCGGGGTCGTTGAAGACCACCTCAAAAGACTTGATCTTCTTGAACATCACGCCGCCAGACGCGTAGTCGGGCACGTCGTAGGGGTAGCCAGAAGCGTAGTCTGGGACGTCGTATGGGTAAGACATGATTGAGCCGAGTGGGTTCAAGAAAAACGAAAGCCGGAGAGGAAAAAAATCTTTAAGAACCC.

Allele

Symbol: Txnip^em1Ngwu
Name: endonuclease-mediated mutation 1, Ning Wu
MGI accession ID: MGI:7482010
Generation method: Endonuclease-mediated
Attributes: Epitope tag
Synonyms: NTX
Marker symbol: Txnip
Marker name: thioredoxin interacting protein
Marker synonyms: ARRDC6; EST01027; HHCPA78; Hyplip1; mVDUP1; THIF; VDUP1
Chromosome: 3
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 endonuclease-mediated genome editing using crRNA/tracrRNA duplex gRNA (crRNA: GAACCCACUCGGCUCAAUCAGUUUUAGAGCUAUGCU, universal tracer RNA: AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU) is designed to insert an N-terminal double HA tag immediately downstream of the initial Met start codon with SerGlyGly as the linker peptide.