B6(CBA)-Pcdhg^em2Rwb/JaweJ

Stock number: 038338
Product name: Pcdhg^CTD
Strain synonyms: Pcdhg(CTD)
Research areas: Developmental Biology Research, Neurobiology Research

Description

Pcdhg^CTD mice carry a CRISPR/Cas9-generated 15-amino acid C-terminal deletion (CTD) in the Pcdhgc3 gene within the protocadherin gamma cluster (Pcdhg) on chromosome 18. This mutation creates a premature STOP codon and removes both the PKC target (S119) and the phospholipid-binding, lysine-rich motif. This strain is useful when studying neuronal structure and function of hypothalamic neuronal circuitry.

Detailed description

Pcdhg^CTD mice carry a CRISPR/Cas9-generated 15-amino acid C-terminal deletion (CTD) in the third "constant" exon shared by all 22 transcripts generated from the protocadherin gamma cluster (Pcdhg) on chromosome 18. The mouse Pcdhg cluster (like the human PCDHG cluster) encodes 22 distinct cell adhesion molecules, the γ-Pcdhs, each of which has a unique extracellular and proximal cytoplasmic domain coupled to a shared cytoplasmic "constant" domain. These neural adhesion proteins play critical roles in the establishment and function of specific cell-cell connections in the brain. They are involved in multiple aspects of neurodevelopment including neuronal survival, dendrite arborization, and synapse development. This strain has a mutation in the shared C-terminal constant exon 3 that generates a premature STOP codon. This mutation results in all 22 of the γ-Pcdh protein isoforms harboring a 15-amino acid deletion in the constant region that removes a C-terminal phospholipid-binding, lysine-rich motif that also contains a serine residue (S119, numbered starting from the first residue of the constant exon) that is the target of phosphorylation by protein kinase C.

Phosphorylation of Serine 119 (S119) by PKC inhibits the ability of γ-Pcdh protein to inhibit their binding partner FAK, which is necessary for normal dendritic arborization in the cerebral cortex. Loss of this negative regulation point results in a relative gain-of-function for γ-Pcdhs, and the Pcdhg^CTD mouse exhibits increased dendrite arborization in cortical neurons compared to WT mice, with no change in density and maturation of dendritic spines detected. The Pcdhg^CTD mouse brain also expresses reduced levels of γ-Pcdh proteins, for an unknown reason.

Homozygous mice are viable and fertile.

Development

A guide RNA (TAATACGACTCACTATAGAAGGCTCCAGCAGGTGGTAAGTTTAAGAGCTATGCTGGAAAC) was designed to create an early STOP codon (GGT to TAA) near the C-terminus of third protocadherin gamma cluster (Pcdhg) constant exon, resulting in a 15-amino acid C-terminal deletion in the constant domain of all 22 γ-Pcdh protein isoforms. A silent protospacer adjacent motif (PAM) site mutation (AAGGCTCCAGCAGGTGGTAA) is present. sgRNA and Cas9 mRNA were introduced into the cytoplasm of C57BL/6J-derived zygotes with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant C57BL/6J females (Stock No. 000664). Pcdhg^CTD pups were identified by PCR and Sanger sequencing, and founder mice were further bred to C57BL/6J mice for at least 10 generations by the donating laboratory to remove off-target CRISPR changes. These mice were also bred to thy1-YFP-H mice (Stock No. 003782), and this transgene was bred out of mice sent to The Jackson Laboratory. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Pcdhg^em2Rwb
Name: endonuclease-mediated mutation 2, Robert W Burgess
MGI accession ID: MGI:5644501
Generation method: Endonuclease-mediated
Attributes: Modified isoform(s)
Synonyms: deltaC15
Marker symbol: Pcdhg
Marker name: protocadherin gamma cluster
Marker synonyms: PCDHG@
Chromosome: 18
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 mediated mutation, a guide RNA (TAATACGACTCACTATAGAAGGCTCCAGCAGGTGGTAAGTTTAAGAGCTATGCTGGAAAC) was designed to create an early STOP codon (GGT to TAA) near the C-terminus of third protocadherin gamma cluster (Pcdhg) constant exon, resulting in a 15-amino acid C-terminal deletion in the constant domain of all 22 gamma-Pcdh protein isoforms.