B6(CBA)-Pcdhg^em3Rwb/JaweJ

Stock number: 038336
Product name: Pcdhg^C3KO
Research areas: Developmental Biology Research, Neurobiology Research

Description

Pcdhg^C3KO mice carry a CRISPR/Cas9-generated mutation in the Pcdhgc3 gene within the protocadherin gamma cluster (Pcdhg) on chromosome 18, making this strain useful when studying neuronal structure and function of hypothalamic neuronal circuitry.

Detailed description

Pcdhg^C3KO mice carry a CRISPR/Cas9-generated mutation Pcdhgc3 gene within the protocadherin gamma cluster (Pcdhg) on chromosome 18. The mouse Pcdhg cluster (like the human PCDHG cluster) encodes 22 distinct cell adhesion molecules, each of which has a unique extracellular and proximal cytoplasmic domain coupled to a shared cytoplasmic "constant" domain. These neural adhesion proteins play critical roles in the establishment and function of specific cell-cell connections in the brain. They are involved in multiple aspects of neurodevelopment including neuronal survival, dendrite arborization, and synapse development. Specifically, the γC3 isoform encoded by Pcdhgc3 interacts with Axin1, a Wnt-pathway scaffold protein that regulates the differentiation and morphology of neurons. This strain has a 13 base pair deletion in the γC3 variable exon that causes a frameshift mutation after base pair 8. This 5' mutation only affects one isoform of the 22 cell adhesion molecules encoded by this gene.

Both male and female mice lacking γC3 exhibit disrupted Axin1 localization to synaptic fractions, without obvious changes in dendritic spine density or morphology. However, both male and female γC3 knock-out mice exhibit severely decreased dendritic complexity of cortical pyramidal neurons.

Homozygous mice are viable and fertile.

Development

A guide RNA (GGCTTACCAGTCCGCTGCTCCGG) was designed to create a 13 base pair deletion in the C3 variable exon of the protocadherin gamma cluster (Pcdhg) gene that causes a frameshift mutation after base pair 8. This 5' mutation only affects one isoform of the 22 cell adhesion molecules encoded by this gene cluster. A silent protospacer adjacent motif (PAM) site mutation (GGC) was introduced to create a small frame-shift deletion just downstream of the initiator codon. sgRNA and Cas9 mRNA were introduced into the cytoplasm of C57BL/6J-derived zygotes with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant C57BL/6J females (Stock No. 000664). Pcdhg^C3KO pups were identified by PCR and founder mice were further bred to C57BL/6J mice for at least 5 generations by the donating laboratory to remove off-target CRISPR changes. These mice were subsequently bred to thy1-YFP-H mice (Stock No. 003782), this allele was removed by the donating laboratory from the mice sent to The Jackson Laboratory (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Two of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, on Chromosomes 8 and 19. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Pcdhg^em3Rwb
Name: endonuclease-mediated mutation 3, Robert W Burgess
MGI accession ID: MGI:5644502
Generation method: Endonuclease-mediated
Attributes: Modified isoform(s)
Synonyms: C3KO
Marker symbol: Pcdhg
Marker name: protocadherin gamma cluster
Marker synonyms: PCDHG@
Chromosome: 18
Strain of origin: C57BL/6J
Molecular note: This CRISPR/Cas9 mediated mutation is a 13 base pair deletion in exon C3 that causes a frameshift mutation after base pair 8.