STOCK Rnd3^em1Nses/J

Stock number: 038297
Product name: Rnd3^fl
Research areas: Cell Biology Research, Neurobiology Research, Research Tools

Description

Rnd3^fl/fl mice carry a CRISPR/Cas9 generated mutation that results in loxP sites flanking exon 3 of the Rho family GTPase 3. This strain may be useful for studying corticospinal motor neuron projections and axon guidance.

Detailed description

Rnd3^fl/fl mice carry a CRISPR/Cas9 generated mutation that results in loxP sites flanking exon 3 of the Rho family GTPase 3 (Rnd3) gene. Rnd3 encodes an enzyme expressed by corticospinal neurons (CSNs) and radial glia/neural stem cells that binds only GTP yet has no GTPase activity. It acts as a negative regulator of cytoskeletal organization leading to loss of adhesion. Mice that are homozygous for this allele are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exon 3 removed in the cre-expressing tissues of the offspring.

Development

Guide RNAs (ATCAGAGAGCTCCTATGCAT and TTTCCTCCAAAAAACGAACG) were designed to insert loxP sites flanking exon 3 of the Rho family GTPase 3 (Rnd3) gene. gRNAs and the Cas9 mRNA were introduced into the cytoplasm of C57BL/6J-derived zygotes with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Rnd3^fl pups were identified by PCR and sequencing and founder mice were crossed to generate homozygotes. Rnd3^fl/fl mice were further bred to C57BL/6J mice for 3 generations by the donating laboratory to develop the colony (see SNP note below). No off-target CRISPR changes were detected. Cryopreserved sperm was shipped to The Jackson Laboratory. Upon arrival, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664) to establish our live colony.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Most of the 43 markers throughout the genome were segregating with an unknown source. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed genetic background.

Allele

Symbol: Rnd3^em1Nses
Name: endonuclease-mediated mutation 1, Senad Sestan
MGI accession ID: MGI:7511886
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Rnd3^fl
Marker symbol: Rnd3
Marker name: Rho family GTPase 3
Marker synonyms: 2610017M01Rik; ARHE; memB; Rho8; Rhoe
Chromosome: 2
Strain of origin: C57BL/6J
Molecular note: Guide RNAs (ATCAGAGAGCTCCTATGCAT and TTTCCTCCAAAAAACGAACG) were designed to insert loxP sites flanking exon 3.