129S.FVB-Syna^em1(cre)Mdf/J

Stock number: 038270
Product name: SynaCre
Research areas: Developmental Biology Research, Internal/Organ Research, Research Tools

Description

SynaCre CRISPR-derived knock-in mice are designed to have P2A-Cre sequence inserted immediately before the stop codon of the syncytin a gene. The endogenous Syna promoter directs expression of Cre recombinase to placental syncytiotrophoblasts (SCTB1). These mice are useful for studying gene functions in late gestation placentas, as well as for studying pregnancy complications and fetal abnormalities.

Detailed description

SynaCre CRISPR-derived knock-in mice are designed to have P2A-Cre sequence inserted immediately before the stop codon of the syncytin a (Syna) gene. SYNA is a retro-viral envelope gene essential for placental syncytiotrophoblast 1 (SCTB1) formation Specifically, Syna is exclusively expressed in mature placentas in SCTB1, one of two SCTB layers that separate maternal and fetal circulation and play essential functions including nutrient and oxygen transport, waste removal, and hormone synthesis. The presence of P2A-Cre cassette allows for expression of Syna and cre. Heterozygous mice are viable and fertile, the donating investigator has not attempted to make a homozygous colony. When these mice are bred with mice containing loxP-flanked sequence, Cre-mediated recombination will result in deletion of the loxP-flanked sequences in Cre-expressing cells.

When Dmt1^-/+;SynaCre males, containing an Dmt1^-/+ knock-out allele derived from Dmt1^fl mice (Stock No. 017789), are bred to homozygous Dmt1^fl/fl females, Dmt1 knock-out in the placentas of resulting female pKO offspring results in normal embryos and placentas with no histological abnormalities.

Of note, SynbCre mice are a similar CRISPR-derived knock-in of a P2A-Cre before the stop codon of the syncytin b (Synb) gene and is available as (Stock No. 038200). SynbCre mice express P2A-Cre in the SCTB2 layer of the placenta.

Development

A sgRNA (GGAGGAGGATGCCGTCTAGC) was used to insert a porcine teschovirus-1 2A oligopeptide (P2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a Cre recombinase sequence (cre) immediately before the stop codon of the syncytin a (Syna) gene (ENSMUSG00000085957). sgRNA, single-stranded donor DNA (ssDNA), and the Cas9 nuclease were introduced into the cytoplasm of fertilized eggs with well recognized pronuclei from FVB/NJ mice. Embryos were transferred to pseudopregnant females. Correctly targeted SynaCre pups were identified by PCR and were further bred to 129S6/SvEvTac mice for at least 5 generations to remove off-target sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize 129S1/SvImJ oocytes (Stock No. 002448).

Allele

Symbol: Syna^em1(cre)Mdf
Name: endonuclease-mediated mutation 1, Mark D Fleming
MGI accession ID: MGI:7484063
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Marker symbol: Syna
Marker name: syncytin a
Marker synonyms: envFRD; ERVFRDE1; GLLL6191; Gm52; HERV-FRD; HERV-W/FRD; syncytin-A; UNQ6191
Chromosome: 5
Strain of origin: FVB/NJ
Molecular note: Using CRISPR/Cas9 methodologies a porcine teschovirus-1 2A oligopeptide (P2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a Cre recombinase sequence (cre) was inserted immediately before the stop codon of the syncytin a (Syna) gene.