129S;FVB-Synb^em1(cre)Mdf/J

Stock number: 038200
Product name: SynbCre
Research areas: Developmental Biology Research, Internal/Organ Research, Research Tools

Description

SynbCre CRISPR-derived knock-in mice are designed to have P2A-Cre sequence inserted immediately before the stop codon of the syncytin b gene. The endogenous Synb promoter directs expression of Cre recombinase to the placental syncytiotrophoblast 2 (SCTB2) layer of the placenta. These mice are useful for studying gene functions in late gestation placentas, as well as for studying pregnancy complications and fetal abnormalities.

Detailed description

SynbCre CRISPR-derived knock-in mice are designed to have P2A-Cre sequence inserted immediately before the stop codon of the syncytin b (Synb) gene. SYNB is a retro-viral envelope gene essential for placental syncytiotrophoblast 2 (SCTB2) formation Specifically, Synb is exclusively expressed in mature placentas after embryonic day (E) 11.5 in SCTB2, one of two SCTB layers that separate maternal and fetal circulation and play essential functions including nutrient and oxygen transport, waste removal, and hormone synthesis. The presence of P2A-Cre cassette allows for expression of Synb and cre. Heterozygous mice are viable and fertile, the donating investigator has not attempted to make a homozygous colony. When these mice are bred with mice containing loxP-flanked sequence, Cre-mediated recombination will result in deletion of the loxP-flanked sequences in Cre-expressing cells.

When Fpn1^-/+;SynbCre males, containing an Fpn1^-/+ knock-out allele derived from Fpn1^flox mice (Stock No. 017790), are bred to homozygous Fpn1^fl/fl females, Fpn1 knock-out in the placentas of resulting pKO female offspring produces pale and runted embryos that died before birth. Fpn1 null placentas from these females have reduced transferrin receptor expression, increased oxidative stress and detoxification responses, and accumulated ferritin in the SCTB instead of the fetal endothelium.

Of note, SynaCre mice are a similar CRISPR-derived knock-in of a P2A-Cre before the stop codon of the syncytin a (Syna) gene and is available as (Stock No. 038270). SynaCre mice express P2A-Cre in the SCTB1 layer of the placenta.

Development

A sgRNA (GACACCATTCCTACATAACA) was used to insert a porcine teschovirus-1 2A oligopeptide (P2A) self-cleaving peptide, to mediate ribosomal skipping, fused to a Cre recombinase sequence (cre) immediately before the stop codon of the syncytin b (Synb) gene (ENSMUSG00000047977). sgRNA, single-stranded donor DNA (ssDNA), and the Cas9 nuclease were introduced into the cytoplasm of fertilized eggs with well recognized pronuclei from FVB/NJ mice. Embryos were transferred to pseudopregnant females. Correctly targeted SynbCre pups were identified by PCR and were further bred to 129S6/SvEvTac mice for at least 5 generations by the donating laboratory (see SNP note below) to remove off-target sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize 129S1/SvImJ oocytes (Stock No. 002448).

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Four of the 43 markers throughout the genome were segregating with FVB, suggesting an incomplete backcross.

Allele

Symbol: Synb^em1(cre)Mdf
Name: endonuclease-mediated mutation 1, Mark D Fleming
MGI accession ID: MGI:7433162
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: SynbCre
Marker symbol: Synb
Marker name: syncytin b
Marker synonyms: D930020E02Rik; envFRD; ERVFRDE1; GLLL6191; HERV-FRD; HERV-W/FRD; RGD1566115; syncytin-B; UNQ6191
Chromosome: 14
Strain of origin: FVB/NJ
Molecular note: Using CRISPR targeting, 2A (P2A) and Cre were inserted immediately before the stop codon of the Synb gene.