C57BL/6-Igk^em1Vic/J

Stock number: 038152
Product name: Igk^Tag
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Research Tools, Virology Research

Description

Igk^Tag (K-tag) knock-in mice have a loxP-flanked FLAG-tag, followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag inserted into the C-terminus of the immunoglobulin kappa chain complex (Igk) gene. Prior to Cre exposure, mice express FLAG-tagged B cell receptors. Upon Cre exposure, recombination of the loxP sites results in the removal of the FLAG-tag and expression of the Strep-II tag in Cre-expressing tissues. These mice allow for molecular fate-mapping of serum antibodies and can specifically be used to ascribe the cellular and temporal origin of serum antibodies to B cell reactions of interest.

Detailed description

Igk^Tag (K-tag) knock-in mice have a loxP-flanked FLAG-tag, followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag inserted into the C-terminus of the immunoglobulin kappa chain complex (Igk) gene. Prior to Cre exposure, mice express FLAG-tagged B cell receptors on 50% or 95% of B cells from heterozygous and homozygous mice, respectively. Like C57BL/6J wildtype mice, approximately 5% of B cells in homozygous Igk^Tag/Tag mice carry an Igλ light chain. Upon Cre exposure, recombination of the loxP sites results in the removal of the FLAG-tag and expression of the Strep-II tag in Cre-expressing cells. For example, when mice are bred to Cd79a^Cre/+ mice (Stock No. 020505), which constitutively express Cre recombinase in all B cells, the FLAG-tagged B cell receptors are replaced with Strep-tagged ones. Igk^Tag/Tag mice appropriately secrete FLAG- or Strep-tagged antibodies into serum in the absence or presence of Cd79a-cre recombinase, respectively, without affecting steady state serum antibody levels. Mice that are homozygous for the Igk^Tag/Tag allele are viable and fertile. Generation and maturation of K-tag B cells is unimpaired, as indicated by the equal proportion of tagged and untagged circulating B cells in Igk^WT/Tag mice.

FLAG- and Strep-tag expressing cells are equally competitive, as indicated by their equal proportion amongst circulating B cells and bone marrow plasma cells in Igk^FLAG/Strep mice in which one of the two K-tag alleles was pre-recombined by Cre expression in the germline (an occasional byproduct of breeding to Cd79a^Cre/+). The donating investigator also confirmed equal competitiveness of antigen-specific antibody responses in Igk^FLAG/Strep mice.

When mice are bred to mice with tamoxifen-inducible Cre recombinase expression, the FLAG-tag is removed in cells expressing Cre at the time of tamoxifen administration. For example, when coupled to the S1pr2-CreERT2 BAC-transgenic allele to generate S1pr2-Igk^Tag mice, germinal center (GC) cells, and the antibodies that their progeny cells secrete can be fate-mapped with temporal control. S1pr2-Igk^Tag/Tag mice treated with tamoxifen on days 4 and 8 after immunization efficiently recombine the K-tag allele to express the Strep-tag in GC B cells, but not in non-GC B cells in the same lymph node. S1pr2-Igk^Tag/Tag mice treated with tamoxifen on days 4, 8 and 12 after immunization accumulated GC-derived, affinity-matured Strep⁺ antigen-specific antibodies in the serum. The donating investigator reports minimal spontaneous recombination in S1pr2-Igk^Tag mice not treated with tamoxifen. In repeat immunization experiments in which tamoxifen was administered only during the primary response, all primary GC cohort-derived antibodies, including antibodies originating from memory or plasma cell derived from the primary GC, are Strep⁺, whereas any antibody produced by B cells expanded by secondary or higher-order boosting, including by their memory or plasma cell progeny are reverse fate-mapped as FLAG⁺.

Thus, Igk^Tag mice allow for molecular fate-mapping of serum antibodies and can specifically be used to ascribe the cellular and temporal origin of serum antibodies to B cell reactions of interest.

Development

Guide RNA (GGAGCTGGTGGTGGCGTCTC) were designed to introduce a loxP-flanked FLAG-tag (DYKDDDDK), followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag (WSHPQFEK) into the C-terminus of the immunoglobulin kappa chain complex (Igk) gene. The guide RNA, a 522bp ssDNA template, and the cas9 nuclease were injected into the cytoplasm of zygotes derived from C57BL/6J mice by pronuclear injection. Correctly targeted embryos were transferred to pseudopregnant females. One Igk^Tag founder pup was identified by sequencing and PCR and was subsequently backcrossed to C57BL/6J mice (Stock No. 000664) for at least 5 generations to decrease the risk of potential off-target CRISPR sites by the donating laboratory (see SNP note below). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. One of the 5 markers that determine C57BL/6J from C57BL/6N was found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Igk^em1Vic
Name: endonuclease-mediated mutation 1, Gabriel D Victora
MGI accession ID: MGI:7442151
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Epitope tag
Synonyms: Igk^Tag
Marker symbol: Igk
Marker name: immunoglobulin kappa chain complex
Marker synonyms: kappa
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: Guide RNA (GGAGCTGGTGGTGGCGTCTC) is designed to introduce a loxP-flanked FLAG-tag (DYKDDDDK), followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag (WSHPQFEK) into the C-terminus of the gene.