C57BL/6J-Igk^em1Vic/J

Stock number: 038152
Product name: Igk^Tag
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Research Tools, Virology Research

Description

Igk^Tag (K-tag) knock-in mice have a loxP-flanked FLAG-tag, followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag inserted into the C-terminus of the immunoglobulin kappa chain complex (Igk) gene. Prior to Cre exposure, mice express FLAG-tagged B cell receptors. Upon Cre exposure, recombination of the loxP sites results in the removal of the FLAG-tag and expression of the Strep-II tag in Cre-expressing tissues. These mice allow for molecular fate-mapping of serum antibodies and can specifically be used to ascribe the cellular and temporal origin of serum antibodies to B cell reactions of interest.

Detailed description

Igk^Tag (K-tag) knock-in mice have a loxP-flanked FLAG-tag, followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag inserted into the C-terminus of the immunoglobulin kappa chain complex (Igk) gene. Prior to Cre exposure, mice express FLAG-tagged B cell receptors on 50% or 95% of B cells from heterozygous and homozygous mice, respectively. Like C57BL/6J wildtype mice, approximately 5% of B cells in homozygous Igk^Tag/Tag mice carry an Igλ light chain. Upon Cre exposure, recombination of the loxP sites results in the removal of the FLAG-tag and expression of the Strep-II tag in Cre-expressing cells. For example, when mice are bred to Cd79a^Cre/+ mice (Stock No. 020505), which constitutively express Cre recombinase in all B cells, the FLAG-tagged B cell receptors are replaced with Strep-tagged ones. Igk^Tag/Tag mice appropriately secrete FLAG- or Strep-tagged antibodies into serum in the absence or presence of Cd79a-cre recombinase, respectively, without affecting steady state serum antibody levels. Mice that are homozygous for the Igk^Tag/Tag allele are viable and fertile. Generation and maturation of K-tag B cells is unimpaired, as indicated by the equal proportion of tagged and untagged circulating B cells in Igk^WT/Tag mice.

FLAG- and Strep-tag expressing cells are equally competitive, as indicated by their equal proportion amongst circulating B cells and bone marrow plasma cells in Igk^FLAG/Strep mice in which one of the two K-tag alleles was pre-recombined by Cre expression in the germline (an occasional byproduct of breeding to Cd79a^Cre/+). The donating investigator also confirmed equal competitiveness of antigen-specific antibody responses in Igk^FLAG/Strep mice.

When mice are bred to mice with tamoxifen-inducible Cre recombinase expression, the FLAG-tag is removed in cells expressing Cre at the time of tamoxifen administration. For example, when coupled to the S1pr2-CreERT2 BAC-transgenic allele to generate S1pr2-Igk^Tag mice, germinal center (GC) cells, and the antibodies that their progeny cells secrete can be fate-mapped with temporal control. S1pr2-Igk^Tag/Tag mice treated with tamoxifen on days 4 and 8 after immunization efficiently recombine the K-tag allele to express the Strep-tag in GC B cells, but not in non-GC B cells in the same lymph node. S1pr2-Igk^Tag/Tag mice treated with tamoxifen on days 4, 8 and 12 after immunization accumulated GC-derived, affinity-matured Strep⁺ antigen-specific antibodies in the serum. The donating investigator reports minimal spontaneous recombination in S1pr2-Igk^Tag mice not treated with tamoxifen. In repeat immunization experiments in which tamoxifen was administered only during the primary response, all primary GC cohort-derived antibodies, including antibodies originating from memory or plasma cell derived from the primary GC, are Strep⁺, whereas any antibody produced by B cells expanded by secondary or higher-order boosting, including by their memory or plasma cell progeny are reverse fate-mapped as FLAG⁺.

Thus, Igk^Tag mice allow for molecular fate-mapping of serum antibodies and can specifically be used to ascribe the cellular and temporal origin of serum antibodies to B cell reactions of interest.

Development

Guide RNA (GGAGCTGGTGGTGGCGTCTC) were designed to introduce a loxP-flanked FLAG-tag (DYKDDDDK), followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag (WSHPQFEK) into the C-terminus of the immunoglobulin kappa chain complex (Igk) gene. The guide RNA, a 522bp ssDNA template, and the cas9 nuclease were injected into the cytoplasm of zygotes derived from C57BL/6J mice by pronuclear injection. Correctly targeted embryos were transferred to pseudopregnant females. One Igk^Tag founder pup was identified by sequencing and PCR and was subsequently backcrossed to C57BL/6J mice (Stock No. 000664) for at least 5 generations to decrease the risk of potential off-target CRISPR sites. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Igk^em1Vic
Name: endonuclease-mediated mutation 1, Gabriel D Victora
MGI accession ID: MGI:7442151
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Epitope tag
Marker symbol: Igk
Marker name: immunoglobulin kappa chain complex
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: Guide RNA (GGAGCTGGTGGTGGCGTCTC) is designed to introduce a loxP-flanked FLAG-tag (DYKDDDDK), followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag (WSHPQFEK) into the C-terminus of the gene.