C57BL/6J-Trem2^{em3(TREM2)Aduci}/J

Stock number: 038103
Product name: hTREM2-KI
Research areas: Mouse/Human Gene Homologs, Neurobiology Research

Description

hTREM2_KI mice contain wildtype human TREM2 sequence replacing the corresponding mouse sequence. These mice serve as a control for mice carrying the hTREM2*R47H_KI allele, which express human TREM2 with a R47H amino acid substitution within the extracellular Ig-like domain, and may be useful as a control in pre-clinical studies of Alzheimer's disease (AD).

Detailed description

Triggering receptor expressed on myeloid cells 2 (Trem2), encodes a cell surface receptor that binds polyanionic ligands including phospholipids and bacterial lipopolysaccharide. Intracellularly, TREM2 conveys signals via DAP12 (aka TYROBP) to activate myeloid lineage cells during immune responses. In this humanized TREM2 knock-in strain (hTREM2 _KI), mouse genomic DNA between the initiator translation codon in exon 1 and the translation termination codon in exon 5 was replaced by the corresponding wild-type human genomic DNA sequence. This mouse strain serves as a control for mice carrying the hTREM2*R47H_KI allele, which expresses human TREM2 with a R47H amino acid substitution within the extracellular Ig-like domain. TREM2*R47H is one of the strongest genetic risk factors for late-onset Alzheimer's disease (AD). RNA-seq analysis of hippocampus in heterozygous hTREM2_KI 2-month-old mice indicates that the humanized allele is expressed at a level similar to the wild-type Trem2 allele, with no cryptic splicing product from the humanized allele.

To create the hTREM2 _KI allele, mouse genomic DNA between the initiator translation codon in exon 1 and the translation termination codon in exon 5 of the Trem2 gene was replaced with the corresponding human genomic DNA sequence. If additional characterization of these hTREM2_KI mice is performed, we may modify the strain description accordingly.

Both heterozygous and homozygous mice are viable and fertile.

The UCI MODEL-AD Center has made other Alzheimer's disease models with mutant human TREM2 expression available:
hTREM2*R47H_KI mice, carrying the human TREM2 with a R47H amino acid substitution, are available as Stock No. 037497
hTREM2^T96K mice, carrying the human TREM2 with a T96K amino acid substitution, are available as Stock No. 40408
hTREM2^L211P mice, carrying the human TREM2 with a L211P amino acid substitution, are available as Stock No. 40409

Development

The hTREM2*R47H_loxP targeting vector was designed by Masashi Kitazawa's lab [University of California, Irvine] to replace mouse genomic DNA between the initiator translation codon in exon 1 and the translation termination codon in exon 5 of the triggering receptor expressed on myeloid cells 2 (Trem2) gene with the corresponding human genomic DNA sequence flanked by loxP sites located within the 5' and 3' UTRs. A frt-flanked neomycin resistance cassette was also inserted in the 3' UTR. The human TREM2 sequence contained a CGC to CAC mutation at position 47 resulting in an arginine to histidine mutation (R47H) orthologous to the location of human SNP rs75932628. The construct was electroporated into C57BL/6J-derived embryonic stem (ES) cells containing a FLP expression cassette. Correctly targeted ES cells were injected into blastocysts and resulting chimeric hTREM2*R47H_loxP mice, lacking the neo cassette, were bred with C57BL/6J mice (Stock No. 000664).

The Kitazawa Lab discovered that the presence of loxP sites in the hTREM2*R47H_loxP allele was associated with approximately 75% reduction in expression. To restore normal levels of hTREM2*R47H transcripts, the UC Irvine Transgenic Mouse Facility introduced ssODN repair template, tracrRNA, crRNA, and CAS9 nuclease into the cytoplasm of hTREM2*R47H_loxP-derived zygotes with well recognized pronuclei to remove each loxP site and the remaining frt site, sequentially. This also restored the mouse 5' UTR and 3' UTR sequences. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germ line transmission. This resulting hTREM2*R47H_KI colony was backcrossed to C57BL/6J for at least two generations and is available at The Jackson Laboratory as Stock No. 037497.

The UC Irvine Transgenic Mouse Facility next used hTREM2*R47H_KI-derived zygotes to create this new hTREM2-KI mouse line as Stock No. 038103. Briefly, a ssODN repair template was designed to create a CAC to AGG change at position 47, reverting the R47H mutation to the now non-mutated 47R. The AGG found at position 47 in these hTREM2-KI mice encodes an arginine which is analogous to the CGC found at position 47 in wildtype TREM2. ssODN repair template, crRNA, tracrRNA and CAS9 nuclease were introduced into the cytoplasm of hTREM2*R47H_KI-derived zygotes with well recognized pronuclei. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, also containing two silent mutations (AGG to CGG at position 46 and AAG to AAA at position 48), which were then bred to C57BL/6J mice for germ line transmission. This resulting hTREM2_KI colony was backcrossed to C57BL/6J for at least two generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Trem2^{em3(TREM2)Aduci}
Name: endonuclease-mediated mutation 3, Frank LaFerla
MGI accession ID: MGI:7485952
Generation method: Endonuclease-mediated
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: hTREM2-KI
Marker symbol: Trem2
Marker name: triggering receptor expressed on myeloid cells 2
Marker synonyms: AD17; PLOSL2; TREM-2; Trem2a; Trem2b; Trem2c; Trem2-Mia; Trem2-Mib
Chromosome: 17
Strain of origin: C57BL/6J-Trem2^{em2(TREM2*R47H)Aduci}/J
Molecular note: A guide RNA (GAAGCACTGGGGGAGGCACA) is designed to create a CAC to CGC mutation at position 47, restoring the R47H mutation to the wild-type derived H47R. ssODN repair template, gRNA, tracrRNA and CAS9 nuclease were introduced sequentially into the cytoplasm of C57BL/6-Trem2^{em2(TREM2*R47H)Aduci}-derived zygotes with well recognized pronuclei.