B6(SJL)-Myog^em1.1Tajb/J

Stock number: 038091
Product name: Myog^ntdTom
Research areas: Research Tools

Description

Myog^ntdTom mice have a CRISPR/Cas9-generated 3xNLS-tdTomato cassette replacing the stop codon of the myogenin gene. These mice are useful for visualizing myogenin expressing cells in skeletal muscle and in studies of the dynamics of muscle differentiation.

Detailed description

Myog^ntdTom mice have a CRISPR/Cas9-generated 3xNLS-tdTomato cassette replacing the stop codon of the myogenin (Myog) gene. Insertion of this reporter cassette does not affect endogenous Myog gene expression and tdTomato expression recapitulates endogenous Myog expression. Myogenin is a transcription factor that is expressed during terminal myoblast differentiation in embryonic development and adult muscle regeneration. In these mice, nuclear-localized tdTomato is evident by immunofluorescence and direct fluorescence in differentiating primary myoblasts beginning between E9.75 and E11.5. Homozygous mice are viable and fertile.

Development

Plasmids encoding gRNAs (CACCGCCCAACTGAGATTGTCTGTC and AAACGACAGACAATCTCAGTTGGGC) were designed to replace the stop codon of the myogenin (Myog) gene with a viral T2A oligopeptide (T2A)-3xNLS-tdTomato cassette. A frt-flanked neo cassette was included downstream. The linearized Myog-ntdTOM donor construct, and the cas9 nuclease, were electroporated into C57BL/6J-derived embryonic stem (ES) cells. Correctly targeted ES cells were injected into BALB/c blastocysts and germline transmission was verified by PCR. The resulting chimeric animals were bred to Tg(ACTFLPe)9205Dym mice on a C57BL/6N genetic background (see Stock No. 019100) to remove the neo cassette. These Myog^ntdTom mice were further bred to C57BL/6NRj mice for at least 10 generations by the donating laboratory. It is unknown if any off-taget CRISPR sites are present. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ (Stock No. 005304) oocytes.

Allele

Symbol: Myog^em1.1Tajb
Name: endonuclease-mediated mutation 1.1, Shahragim Tajbakhsh
MGI accession ID: MGI:7442679
Generation method: Endonuclease-mediated
Attributes: Reporter
Synonyms: Myog^ntdTom
Marker symbol: Myog
Marker name: myogenin
Marker synonyms: bHLHc3; MYF4; myf-4; myo
Chromosome: 1
Strain of origin: C57BL/6J
Molecular note: Plasmids encoding gRNAs (CACCGCCCAACTGAGATTGTCTGTC and AAACGACAGACAATCTCAGTTGGGC) are designed to replace the stop codon of the gene with a viral T2A oligopeptide (T2A)-3xNLS-tdTomato cassette. An FRT-flanked neo cassette was included downstream. Flp-mediated recombination removed the neo cassette.