C57BL/6-Susd2^em1Hwen/J

Stock number: 037962
Product name: Susd2^-
Research areas: Cancer Research, Cell Biology Research

Description

The Susd2^- mice have a CRISPR/Cas9 generated deletion of exons 1-15 of the sushi domain containing 2 (Susd2) gene. These mice may be useful for studying the role of Susd2 in tumorigenesis and cancer biology.

Detailed description

Sushi domain containing 2 (SUSD2) is a type I transmembrane protein believed to mediate protein-protein interactions and has been implicated in a variety of cancers. SUSD2 acts as a repressor in some cancers, such as colon or liver, but appears to promote tumorigenesis in breast cancer. SUSD2 may prove to be a valuable therapeutic target for multiple cancers. Using CRISPR/Cas9-mediated genome editing, exons 1-15 of the Susd2 gene, were deleted in this Susd2^- knock-out model.

Homozygous Susd2^- mice are viable and fertile with no overt phenotype. The donating laboratory suggests that these mice may act as a regulator of CD8+ T cells as Susd2^- mice demonstrated significantly enhanced antitumor immune responses. Of note, the donating investigator confirmed SUSD2 activity was absent in CD8+ T cells but did not evaluate other cell types. These mice may be useful for studying the regulatory role of Susd2 in cancer pathology.

Development

The Susd2^- knock-out allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs [GTCCACAGGTGCCGATAGACAGG and GAAATGGGAGCTTCCAACGCAGG] were selected to target the sushi domain containing 2 locus (Susd2) on Chromosome 10. Susd2 transcript NM_027890.5 was used as reference for the exon numbering and the guide/donor sequences. These sequences and Cas9 nuclease were introduced into C57BL/6 zygotes and transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and sequencing. The resulting heterozygous Susd2^- mice were bred to C57BL/6 mice for 3 generations to reduce off-target CRISPR events by the donating laboratory (see SNP note below). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

A 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Two of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Susd2^em1Hwen
Name: endonuclease-mediated mutation 1, Haitao Wen
MGI accession ID: MGI:7432659
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Susd2^-
Marker symbol: Susd2
Marker name: sushi domain containing 2
Marker synonyms: 1200011D11Rik; BK65A6.2; W5C5
Chromosome: 10
Strain of origin: C57BL/6
Molecular note: Using a CRISPR/Cas9-mediated genome engineering strategy, the exon 1-14 of the Susd2 gene was deleted.