C57BL/6-Kcnma1^em3Alme/J

Stock number: 037789
Product name: KCNMA1-H444Q
Research areas: Cell Biology Research, Neurobiology Research

Description

KCNMA1-H444Q knock-in mice express a loss-of-function (LOF) histidine to glutamine substitution at position 444 of the potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (Kcnma1) gene. Mice exhibit locomotor dysfunction and hyperactive dyskinesia. These mice may be useful in studies involving KCNMA1-linked channelopathy.

Additional strains with patient-associated PKND3 mutations include KCNMA1-N999S (Stock No. 037787) and KCNMA1-D434G (Stock No. 037788).

Detailed description

Kcnma1 (potassium large conductance calcium-activated channel, subfamily M, alpha member 1) encodes the pore-forming alpha subunit of the "Big K+" (BK) voltage and calcium-sensitive potassium channel (K_Ca1.1). BK channels are widely expressed in neurons, smooth muscle, neuroendocrine and non-excitable cells such as bone and kidney. In excitable cells, BK channels regulate action potential repolarizations and afterhyperpolarizations, neurotransmitter release, and calcium transients. Human KCNMA1 mutations are primarily associated with neurological conditions, including seizures, movement disorders, developmental delay, and intellectual disability. In mouse models, Kcnma1 null mice (Stock No. 035901 B6.Cg-Kcnma1^tm1.1Alme/J and Stock No. 035902 B6.129(FVB)-Kcnma1^tm1Rwa/J) show prominent neurological and multi-system smooth muscle pathophysiology, as well as alterations in neurosecretory, K+ transport, immune, bone, and ethanol intoxication.

Kcnma1^H444Q knock-in mice express a histidine to glutamic acid substitution at position 444 (H444Q). In heterologous cells, the H444Q mutation produces a loss-of-function (LOF) by slowing BK channel activation, speeding deactivation, and shifting the voltage-dependence of activation to more depolarized potentials. H444Q is located within the βB and αB of the AC domain, which is within the regulator of conductance of potassium 1 (RCK1) domain that regulates calcium-dependent gating. Kcnma1^H444Q mice homozygous for the mutation are viable and fertile with locomotor dysfunction such as hyperkinetic dyskinesia and impaired grip strength. Kcnma1^H444Q heterozygous mice have no apparent abnormalities inclucing no alterations in seizure latency compared to wild type. In order of phenotypic severity, the KCNMA1 mutations are ranked from most to least severe as N999S (Stock No. 037787), D434G (Stock No. 037788), and H444Q.

Additional strains with patient-associated KCNMA1-linked channelopathy mutations include: C57BL/6J-Kcnma1^em1Alme/J (N999S) Stock No. 037787, and C57BL/6J-Kcnma1^em2Alme/J (D434G) Stock No. 037788.

Development

CRISPR/cas9 endonuclease-mediated genome editing was used to create a histidine to glutamine substitution at position 444 (H444Q, c.1332 CAC to CAG) in exon 10 of the Kcnma1 locus on chromosome 14. The mutation is a variant identified in PNKD3 patients. Single guide RNA (GGACCGGGATGATGTCAACG), cas9 endonuclease and single stranded donor oligos (CTCAGAGAGAAGCATGAGTTTAGGTGGCAGGGTCTGGTGGCAGCAGGGGGCTCTTACTTcTGcAGAAAGACgATCTCgACGTTGACATCATCCCGGTCCTTGTGCAGAAAGTCCTTCAGG) were introduced into C57BL/6-derived fertilized eggs by pronuclear injection. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. The colony was crossed to C57BL/6J for more than 6 generations. Upon arrival, mice were bred to C57BL/6J (Stock No. 000664) for at least one generation to establish the colony.

Allele

Symbol: Kcnma1^em3Alme
Name: endonuclease-mediated mutation 3, Andrea Meredith
MGI accession ID: MGI:7384346
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Kcnma1^H444Q
Marker symbol: Kcnma1
Marker name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Marker synonyms: 5730414M22Rik; bA205K10.1; BK channel alpha subunit; BKCa; BKCA alpha; BKTM; CADEDS; cbv1; hSlo; IEG16; k(VCA)alpha; KCa1.1; Kcnma; KCNMA1b; KCNMA1c; LIWAS; maxiK; mSLO1; PNKD3; SAKCA; SLO; Slo1; slo-alpha
Chromosome: 14
Strain of origin: C57BL/6J
Molecular note: CRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting GGACCGGGATGATGTCAACG) and ssODN template (CTCAGAGAGAAGCATGAGTTTAGGTGGCAGGGTCTGGTGGCAGCAGGGGGCTCTTACTTcTGcAGAAAGACgATCTCgACGTTGACATCATCCCGGTCCTTGTGCAGAAAGTCCTTCAGG) to change histidine codon 444 (CAC) in exon 10 to glutamine (CAG) (ENSMUSP00000153247:p.H444Q, ENSMUST00000145596:c.1332C>G). This mutation is associated with paroxysmal non-kinesigenic dyskinesia (PKND3) with or without epileptic seizures in KCNMA1-linked channelopathy patients.