C57BL/6J-Kcnma1^em1Alme/J

Stock number: 037787
Product name: KCNMA1-N999S
Research areas: Cell Biology Research, Developmental Biology Research, Neurobiology Research

Description

KCNMA1-N999S knock-in mice express a gain-of-function (GOF) asparagine to serine substitution at position 999 of the potassium large conductance calcium-activated channel, subfamily M, alpha member 1 gene. Heterozygous mice exhibit lowered seizure thresholds, hypokinetic stress-induced paroxysmal dyskinesia (episodes of immobility), locomotor dysfunction, and increased BK channel activity. These mice may be useful in studies involving KCNMA1-linked channelopathy.

Additional strains with patient-associated KCNMA1-linked channelopathy mutations include KCNMA1-D434G (Stock No. 037788) and KCNMA1-H444Q (Stock No. 037789).

Detailed description

Kcnma1 (potassium large conductance calcium-activated channel, subfamily M, alpha member 1) encodes the pore-forming alpha subunit of the "Big K+" (BK) voltage and calcium-sensitive potassium channel (K_Ca1.1). BK channels are widely expressed in neurons, smooth muscle, neuroendocrine and non-excitable cells such as bone and kidney. In excitable cells, BK channels regulate action potential repolarizations and afterhyperpolarizations, neurotransmitter release, and calcium transients. Human KCNMA1 mutations are primarily associated with neurological conditions, including seizures, movement disorders, developmental delay, and intellectual disability. In mouse models, Kcnma1 null mice (Stock No. 035901 B6.Cg-Kcnma1^tm1.1Alme/J and Stock No. 035902 B6.129(FVB)-Kcnma1^tm1Rwa/J) show prominent neurological and multi-system smooth muscle pathophysiology, as well as alterations in neurosecretory, K+ transport, immune, bone, and ethanol intoxication.

Kcnma1^N999S knock-in mice express gain-of-function (GOF) asparagine to serine substitution at position 999 (N999S; rs886039469). The heterozygous N999S mutation is the most common de novo KCNMA1 variant found in patients (17%), half of which develop seizures, paroxysmal non-kinesigenic dyskinesia (PKND3), or both. N999S is located in the helix bend in the middle of the S10 domain within the regulator of conductance of potassium 2 (RCK2) domain. Mice heterozygous for the mutation are viable, fertile, and replicate the core symptoms experienced by patients. Heterozygote x heterozygote crosses do not produce homozygous progeny. Kcnma1^N999S mice exhibit lowered seizure thresholds, hypokinetic stress-induced paroxysmal dyskinesia (episodes of immobility), locomotor dysfunction, and increased BK channel activity (increased currents [69%] and action potential firing [25-30%]). The stress-induced paroxysmal dyskinesia exhibited by Kcnma1^N999S mice is mitigated by acute dextroamphetamine treatment, consistent with the amphetamine responsiveness of PNKD3-affected patients harboring the N999S variant. In mice, the N999S mutation results in the most severe phenotype and the highest phenotypic similarity to patients harboring KCNMA1 GOF variants, followed by D434G (Stock No. 037788), and H444Q (Stock No. 037789).

Additional strains with patient-associated KCNMA1-linked channelopathy mutations include: C57BL/6J-Kcnma1^em2Alme/J (D434G) Stock No. 037788, and C57BL/6J-Kcnma1^em3Alme/J (H444Q) Stock No. 037789.

Development

CRISPR/Cas9 endonuclease-mediated genome editing was used to create an asparagine to serine substitution at position 999 (N999S, AAT to AGT) in exon 25 of the Kcnma1 locus on chromosome 14. The mutation is a variant identified in PNKD3 patients. Single guide RNA (CTGTATGAAGTTACTGTTAT), cas9 endonuclease and single stranded donor oligos were introduced into C57BL/6-derived fertilized eggs by pronuclear injection. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. The colony was crossed to C57BL/6J for more than 6 generations. Upon arrival, mice were bred to C57BL/6J (Stock No. 000664) for at least one generation to establish the colony.

Allele

Symbol: Kcnma1^em1Alme
Name: endonuclease-mediated mutation 1, Andrea Meredith
MGI accession ID: MGI:7384340
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Kcnma1^N999S
Marker symbol: Kcnma1
Marker name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Marker synonyms: 5730414M22Rik; bA205K10.1; BK channel alpha subunit; BKCa; BKCA alpha; BKTM; CADEDS; cbv1; hSlo; IEG16; k(VCA)alpha; KCa1.1; Kcnma; KCNMA1b; KCNMA1c; LIWAS; maxiK; mSLO1; PNKD3; SAKCA; SLO; Slo1; slo-alpha
Chromosome: 14
Strain of origin: C57BL/6J
Molecular note: CRISPR/Cas9 endonuclease-mediated genome editing was used with an sgRNA (targeting CTGTATGAAGTTACTGTTAT) and ssODN template (AGATACTAAGAAAAGTTGTAATTTGGACATCAATTGTGATTTTCGGTGTTGGCTTAAGAATGCTTCTCTTCTACCTTCTTTCTCCAGACATAtTTCAgTGACAATATtCTCACCCTAATACGGACCCTGGTGACAGGAGGAGCCACACCA) to change asparagine codon 995 (AAT) in exon 25 to serine (AGT) (ENSMUSP00000140033:p.N995S). This mutation is the equivalent of the human p.N999S mutation which, in heterozygous form, is the most common de novo KCNMA1 variant found in KCNMA1-linked channelopathy patients (17%), half of which develop seizures, paroxysmal non-kinesigenic dyskinesia (PKND3), or both.