C57BL/6-Rr253^em1Kmm/J

Stock number: 037707
Product name: Zeb2^delta-165
Research areas: Cell Biology Research, Immunology, Inflammation and Autoimmunity Research

Description

Zeb2^delta-165 mice carry CRISPR/Cas9 generated deletion of the entire -165 kb zinc finger E-box binding homeobox 2 (Zeb2) enhancer in the Rre253 regulator region. This strain may be useful for studying the divergence of the common dendritic cell progenitors (CDP) into the conventional type 1 and type 2 dendritic cell (cDC1 and cDC2).

Detailed description

Zeb2^delta-165 mice carry CRISPR/Cas9 generated deletion of the entire -165 kb zinc finger E-box binding homeobox 2 (Zeb2) enhancer (364 bp) of the Rre253 regulator region. ZEB2 is a transcription factor that is repressed during pre- conventional type 1 dendritic cell (cDC1) differentiation yet is required for plasmacytoid dendritic cell (pDC) development. The -165 kb Zeb2 enhancer has three binding sites for NFIL3, which has been shown to repress Zeb2 expression. In this mouse line, the entire -165 kb Zeb2 enhancer has been removed.

These mutant mice have a 97% reduction of B cells as percentage of splenocytes (99% reduction in absolute number) when compared to wildtype mice. They have no pDCs or monocytes. They also have increased numbers of NK cells and T cells. As such, they have increased susceptibility to viral infection induced death.

Homozygous mice are viable and fertile.

In contrast, Δ1+2+3 mice (Stock No. 037704) lack the three NFIL3 binding sites in the -165 kb Zeb2 enhancer in the Rre253 regulator region. They show an increase in cDC1 development and the complete loss of pre-cDC2 specification and mature cDC2 development in vivo. They have pDCs and B cells, but have decreased monocytes.

Development

Guide RNAs (GAGTGAGAGATCATCAAATG and GATAACGTTCTTGAAGCATA) were used to delete the -165 kb zinc finger E-box binding homeobox 2 (Zeb2) enhancer (364 bp) of the Rre253 regulator region. Guide RNAs were conjugated with purified Cas9 protein to form the RNP complex, which was then introduced into the cytoplasm of zygotes derived from C57BL/6J mice by electroporation. Correctly targeted embryos were transferred to pseudopregnant females. Resulting Zeb2^delta-165 pups were identified by Sanger sequencing and PCR and were screened for the mutations prior to weaning. The donating laboratory reports these mice were further maintained on a C57BL/6J genetic background (see SNP note below). It is unknown if any off-target CRISPR sites are present. Upon arrival at The Jackson Laboratory in 2023, the strain was bred one generation to C57BL/6J inbred mice (Stock No. 000664) to establish our live colony. The strain was later cryopreserved as sperm.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the first generation of rederived living mice at The Jackson Laboratory Repository. All five of the markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Rr253^em1Kmm
Name: endonuclease-mediated mutation 1, Kenneth M Murphy
MGI accession ID: MGI:7331606
Generation method: Endonuclease-mediated
Attributes: Modified regulatory region
Synonyms: Zeb2^delta-165
Marker symbol: Rr253
Marker name: regulatory region 253
Marker synonyms: Zeb2 -165 kb
Chromosome: 2
Strain of origin: C57BL/6
Molecular note: The Zeb2 enhancer, containing four E-boxes and located ~165 kb upstream, was targeted with sgRNAs (targeting GAGAGATCATCAAATG and GATAACGTTCTTGAAGCATA) using CRISPR/Cas9 technology, resulting in a 364 bp deletion.