B6.Cg-Tnfrsf9^em1Kmm/J

Stock number: 037706
Product name: 41bb^-
Strain synonyms: Tnfrsf9^-
Research areas: Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Tnfrsf9^- mice carry CRISPR/Cas9 generated deletion of exon 2, including the translation initiation site, of the Tnfrsf9 gene. This strain may be useful for studying antigen cross-presentation, and CD8 T cell responses against viral infection and responses to tumor challenge.

Detailed description

Tnfrsf9^- mice carry CRISPR/Cas9 generated deletion of exon 2, including the translation initiation site, of the tumor necrosis factor receptor superfamily, member 9 (Tnfrsf9) gene. Also called 41bb, TNFRSF9 encodes CD137L, that, along with its receptor, CD137, is involved in the interaction between antigen presentation cells and T cells. It is also a candidate gene of insulin dependent diabetes susceptibility 9.3 (Idd9.3).

These mutant mice exhibit loss of 4-1BB expression on activated CD8 T cells and have no impairment of tumor rejection when induced with fibrosarcomas.

Homozygous mice are viable and fertile.

Development

Guide RNAs (tgcatgtgacatttcgccatggg and gttatcacaggagttctgcacgg) were used to delete exon 2, including the translation initiation site, of the tumor necrosis factor receptor superfamily, member 9 (Tnfrsf9) gene. Guide RNAs were conjugated with purified Cas9 protein to form the RNP complex, which was then introduced into the cytoplasm of zygotes derived from CD27 KO mice (see Stock No. 019009) by electroporation. Correctly targeted embryos were transferred to pseudopregnant females. Resulting Tnfrsf9^- pups were identified by Sanger sequencing and PCR and were screened for the deletion prior to weaning. The donating laboratory reports these mice were further maintained on a C57BL/6J genetic background (see SNP note below). It is unknown if any off-target CRISPR sites are present. Upon arrival at The Jackson Laboratory in 2023, the strain was bred one generation to C57BL/6J inbred mice (Stock No. 000664) to establish our live colony. The strain was later cryopreserved as sperm.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the first generation of rederived living mice at The Jackson Laboratory Repository. Two of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus and one SNP on Chromosome 19. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Tnfrsf9^em1Kmm
Name: endonuclease-mediated mutation 1, Kenneth M Murphy
MGI accession ID: MGI:7521992
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Tnfrsf9
Marker name: tumor necrosis factor receptor superfamily, member 9
Marker synonyms: 4-1BB; A930040I11Rik; CD137; CDw137; ILA; IMD109; Ly63
Chromosome: 4
Strain of origin: B6.129P2(FVB)-Cd27^tm1Jbo/J
Molecular note: Guide RNAs (tgcatgtgacatttcgccatggg and gttatcacaggagttctgcacgg) are used to delete exon 2, including the translation initiation site.