C57BL/6-Rr253^em6Kmm/J

Stock number: 037704
Product name: Δ1+2+3
Research areas: Cell Biology Research, Immunology, Inflammation and Autoimmunity Research, Virology Research

Description

Δ1+2+3 mice carry CRISPR/cas9 generated mutations of the three NFIL3 binding sites in the -165 kb zinc finger E-box binding homeobox 2 (Zeb2) enhancer in the Rr253 regulator region. This strain may be useful for studying the divergence of the common dendritic cell progenitors (CDP) into the conventional type 1 and type 2 dendritic cell (cDC1 and cDC2).

Detailed description

Δ1+2+3 mice carry CRISPR/cas9 generated deletions of the three NFIL3 binding sites in the -165 kb zinc finger E-box binding homeobox 2 (Zeb2) enhancer in the Rr253 regulator region. ZEB2 is a transcription factor that is repressed during pre-conventional type 1 dendritic cell (cDC1) differentiation yet is required for plasmacytoid dendritic cell (pDC) development. The -165 kb Zeb2 enhancer has three binding sites for NFIL3, which has been shown to repress Zeb2 expression. In this mouse line, all three binding sites have been altered to eliminate NFIL3 binding.

This triple mutant line removes Zeb2 expression in myeloid, but not lymphoid progenitors, causing an increase in cDC1 development and the complete loss of pre-cDC2 specification and mature cDC2 development in vivo. These mice have pDCs and B cells, but have decreased monocytes.

Homozygous mice are viable and fertile.

In contrast, Zeb2^delta-165 mice (Stock No. 037707) lack the entire -165 kb Zeb2 enhancer and have no pDCs or monocytes. As such, they have increased susceptibility to viral infection induced death.

Development

Guide RNAs (ATACCCATGTTACATAATTA, ATTTTGCAACCCCCCAAAAA, CCGGTGACACACACTGCTCA, and CCACCAGCCGGTGACACACA) were used sequentially to mutate the three NFIL3 binding sites in the -165 kb zinc finger E-box binding homeobox 2 (Zeb2) enhancer in the Rre253 regulator region. Guide RNAs, Cas9 nuclease mRNA, and single strand oligonucleotides were introduced into the cytoplasm of zygotes derived from C57BL/6J mice by electroporation. Correctly targeted embryos were transferred to pseudopregnant females. Resulting Δ1+2+3 pups were identified by Sanger sequencing and PCR and were screened for the mutations prior to weaning. The donating laboratory reports these mice were further maintained on a C57BL/6J genetic background (see SNP note below). It is unknown if any off-target CRISPR sites are present. Upon arrival at The Jackson Laboratory in 2023, the strain was bred one generation to C57BL/6J inbred mice (Stock No. 000664) to establish our live colony. The strain was later cryopreserved as sperm.

In 2023, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the first generation of rederived living mice at The Jackson Laboratory Repository. Two of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus and one SNP on Chromosome 6. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Rr253^em6Kmm
Name: endonuclease-mediated mutation 6, Kenneth M Murphy
MGI accession ID: MGI:7448467
Generation method: Endonuclease-mediated
Attributes: Modified regulatory region
Synonyms: delta1+2+3
Marker symbol: Rr253
Marker name: regulatory region 253
Marker synonyms: Zeb2 -165 kb
Chromosome: 2
Strain of origin: C57BL/6J
Molecular note: Using zygotes that already carry the Rr253^em4Kmm NFIL3–C/EBP binding site 1&2-deletion allele, binding site 3 in the Zeb2 enhancer, located ~165 kb upstream, were targeted with an sgRNA (targeting CCACCAGCCGGTGACACACA) and an ssODN template (GCTGAAGTTCACCTCCCCATGGGGGAATGAATCATCAAAATAACCGGTGGAAAACAAGCTAGATCTGACTTGAGCAGTGTGTGTCACCGGCTGGTGGAATTTTTAGAAAGGCAGCAGTTTGGGCTCATCACTGCGGTT) using CRISPR/Cas9 technology, resulting in an allele lacking binding sites 1, 2 and 3.