B6.Cg-Adipoq^em1(cre)Oam/J

Stock number: 037702
Product name: FAC
Research areas: Internal/Organ Research, Research Tools

Description

FAC (FLPo-dependent Adipoq-Cre) knock-in mice express a FLPo-inducible Cre recombinase under the control of the Adipoq (adiponectin, C1Q and collagen domain containing) endogenous promoter. Following FLPo-mediated recombination cre is expressed in adipose tissue. This strain may be used in studies of bone marrow adipocytes and bone homeostasis.

To create BMAd-Cre mice, FAC mice are combined with a FLP expressed in osteoblasts and bone marrow adipocytes (B6.Cg-Sp7^em1(flpo)Oam/J, Stock No. 037208), this combination creates cre expression directed exclusively to bone marrow adipocytes, but not to osteoblasts or other adipose depots.

Detailed description

FAC (FLPo-dependent Adipoq-Cre) knock-in mice express a FLPo-inducible Cre recombinase under the control of the Adipoq (adiponectin, C1Q and collagen domain containing) endogenous promoter. Adipoq encodes a protein involved in metabolism that is expressed only in adipocytes. Mice homozygous for the mutation are viable, heterozygous mice are used for breeding. The donating investigator notes that cre efficiency is 80% in heterozygous male and female mice over 16 weeks of age and is 90% in homozygous mice over 12 weeks of age; efficiency is reduced in mice younger than 16 weeks. In addition, insertion of the Cre cassette decreases expression of adiponectin protein in white adipose tissue (WAT) and bone marrow adipocytes by 50%, and reduces circulation of adiponectin resulting in hypoadiponectinemia. Body weight, glucose tolerance, WAT deposits, and tibial trabecular and cortical bone variables are unaffected by the hypoadipnectinemia.

When crossed with a strain expressing a FLP recombinase, the cre sequence is irreversibly moved into the correct orientation and is expressed under the direction of the Adipoq promoter. Following FLP-mediated recombination, FAC mice may be crossed to a strain containing a loxP site flanked sequence of interest, and offspring will be useful for generating cre-mediated targeted deletions in adipoctyes.

To create bone marrow adipocyte BMAd-Cre mice, FAC mice are combined with a FLP expressed in osteoblasts and bone marrow adipocytes (B6.Cg-Sp7^em1(flpo)Oam/J, Stock No. 037208), this combination creates cre expression directed exclusively to bone marrow adipocytes, but not to osteoblasts or other adipose depots.

Development

CRISPR/cas9 endonuclease-mediated genome editing was used to insert an IRES-F3-FRT-reversed cre-F3-FRT cassette with approximately 1 kb of 5’ and 3' flanking homology arm sequence into the 3' UTR of the Adipoq locus on chromosome 16. Single guide RNAs (tgaacaagtgagtacacgtgtgg and cagtgagcagaaaaatagcatgg), cas9 endonuclease and donor DNA were introduced into C57BL/6J and SJL/J-derived zygotes with well recognized pronuclei. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. Mice were further backcrossed for 8 generations onto the C57BL/6J background by the donating laboratory. The background of the mice was confirmed using the miniMUGA panel [Sigmon et al. 2020 Genetics. 216(4):905-930 (PMID: 33067325)] through Transnetyx (Memphis, TN). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: Adipoq^em1(cre)Oam
Name: endonuclease-mediated mutation 1, Ormond A MacDougald
MGI accession ID: MGI:7294222
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Recombinase-expressing
Marker symbol: Adipoq
Marker name: adiponectin, C1Q and collagen domain containing
Chromosome: 16
Strain of origin: C57BL/6 x SJL
Molecular note: CRISPR/cas9 endonuclease-mediated genome editing was used to insert an in frame protein containing IRES-followed by F3-FRT-Cre-F3-FRT in reverse orientation into the 3' UTR of the gene. The cassette contained approximately 1 kb of 5' and 5' flanking homology arm sequence. Expression of Flpo recombinase recombines cre to the correct orientation.