B6.Cg-Rgs2^em1Jgro/J

Stock number: 037619
Product name: Rgs2^flox
Research areas: Cancer Research, Cardiovascular Research, Cell Biology Research, Neurobiology Research, Research Tools

Description

Rgs2^flox mice possess loxP sites flanking exons 2-4 of the regulator of G-protein signaling 2 (Rgs2) gene. These mice may be useful for studying hypertension and atherosclerosis, as well as neurodegenerative diseases, such as Alzheimer's Disease, and some cancers.

Detailed description

Regulator of G-protein signaling (RGS) proteins play a role in G protein signaling by acting as GTPase-activating proteins (GAPs), which bind to the Gα subunits and alter signal transduction. RGS2 has a high affinity for Gα_i/o and Gα_q/11 subunits and is implicated in regulation of multiple physiologic processes and pathologies, including cardiovascular disease and central nervous system disorders, as well as various forms of cancer. Homozygous Rgs2^flox mice are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exons 2-4 deleted in the cre-expressing tissues. These mice may be useful for studying the role of Rgs2 in cardiovascular, metabolic, and neurodegenerative diseases as well as some cancers.

Development

The Rgs2^flox allele was generated using CRISPR/cas9 endonuclease-mediated homology-directed repair (HDR) genome editing. Guide RNAs (ATGAGCTTTACAAGCAGGAT and GCTGGGATGAGAGGCGCACA) were used to target the introns flanking exons 2-4 of the Rgs2 gene. Rgs2 transcript Rgs2-202 was used as reference for the exon number and the guide sequences. The sgRNAs, ssDNA (repair template), and the cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from B6SJLF1/J (Stock No. 100012) mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Rgs2 ^flox mice were backcrossed to C57BL/6J background for at least 8 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Rgs2^em1Jgro
Name: endonuclease-mediated mutation 1, Justin Grobe
MGI accession ID: MGI:7346183
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Marker symbol: Rgs2
Marker name: regulator of G-protein signaling 2
Chromosome: 1
Strain of origin: (C57BL/6J x SJL/J)F1/J
Molecular note: CRISPR/cas9 genome editing uses guide RNAs (ATGAGCTTTACAAGCAGGAT and GCTGGGATGAGAGGCGCACA) toinsert loxP sited in the introns flanking exons 2-4. Rgs2 transcript Rgs2-202 was used as reference for the exon number and the guide sequences.