C57BL/6-Ppp1r15a^em1Hato/J

Stock number: 037609
Product name: Ppp1r15a uORF
Strain synonyms: uORF^-
Research areas: Cell Biology Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Ppp1r15a uORF mice carry a CRISPR/cas9 generated methionine to isoleucine change change in the start codon of the third upstream open reading frame (uORF3) of the Ppp1r15a gene. This strain may be useful for studying the interplay between kinases and phosphatases involved in the eIF2α axis.

Detailed description

Ppp1r15a uORF mice carry a CRISPR/Cas9 generated ATG to ATA mutation, resulting in a methionine to isoleucine change, in the start codon of the third upstream open reading frame (uORF3, analogous to human uORF2), of the protein phosphatase 1, regulatory subunit 15A (Ppp1r15a) gene. Ppp1r15a, also known as GADD34, encodes one of two regulatory subunits of eIF2α holophosphatases and promotes dephosphorylation of eIF2α. Elimination of Ppp1r15a uORF3 results in an increase in the expression of PPP1R15A protein at baseline in various organs including kidney, heart, liver, lung, and brain. The overall translation is increased in the kidney and brain in Ppp1r15a uORF animals, implicating that low-grade phosphorylation of eIF2α is operative in these tissues under normal conditions. Upon endotoxin challenge, Ppp1r15a uORF mice show preserved translation and less kidney injury as compared to wild-type. Stress-induced eIF2α phosphorylation is a common pathway in the pathophysiology of various diseases. This strain may be useful for studying the interplay between kinases and phosphatases involved in the eIF2α axis.

Homozygous mice are viable and fertile.

Development

A guide RNAs (AGCGGGTTCATGTCGCCCTC) was designed to create an ATG to ATA mutation, resulting in a methionine to isoleucine change, in the start codon of the third upstream open reading frame (uORF3, analogous to human uORF2), of the protein phosphatase 1, regulatory subunit 15A (Ppp1r15a) gene on chromosome 7. A silent protospacer adjacent motif (PAM) site mutation was introduced to prevent gRNA editing of the donor template. sgRNAs, single-stranded donor oligonucleotides (ssODN) (GATATCCCGCGCGACCCCGCATCCCTTTGCCGGCCGGGACAGCCTTTGCTACAGCCTGTGAAACATTGCGTCCCCGAGCCCCACGCGTGAGGGCGACATAAACCCGCTGGCTTCGCGAGCAGTCCGG), and the Cas9 nuclease were introduced into the cytoplasm of C57BL/6J-derived zygotes with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Ppp1r15a uORF pups were identified by Sanger sequencing and PCR and founder mice were further bred to C57BL/6J mice (Stock No. 000664) for one generation to develop the colony. It is unknown if any off-target CRISPR changes are present. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Ppp1r15a^em1Hato
Name: endonuclease-mediated mutation 1, Takashi Hato
MGI accession ID: MGI:7339015
Generation method: Endonuclease-mediated
Attributes: Not Applicable
Marker symbol: Ppp1r15a
Marker name: protein phosphatase 1, regulatory subunit 15A
Chromosome: 7
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing uses guide RNAs (AGCGGGTTCATGTCGCCCTC) to create an ATG to ATA mutation, resulting in a methionine to isoleucine change, in the start codon of the third upstream open reading frame (uORF3, analogous to human uORF2). A silent protospacer adjacent motif (PAM) site mutation was introduced to prevent gRNA editing of the donor template.