B6.FVB-AU040320^em1Janc/J

Stock number: 037596
Product name: Aavr^-, Kiaa0319l^-
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools, Virology Research

Description

Aavr knock-out mice have a frameshift mutation in exon 2 of the AU040320 (also known as Aavr - adeno-associated virus receptor) locus. Mice homozygous for the mutation are resistant to infection with adeno-associated virus (AAV). These mice may be useful in testing virus-based gene therapies.

Detailed description

AAV (adeno-associated virus) vectors are frequently used in virus-based gene therapies. The AAV receptor (AAVR or AU04032) is required for transduction by most serotypes of AAV. Expression of AAVR is required for transduction of most AAV vectors for in vivo transgenesis. Aavr- mice were created using TALEN genome editing to cause a 1 bp deletion causing a frameshift in exon 2 of the AU040320 locus resulting in a null allele. AU040320 has been associated with dyslexia, although no clear phenotypes are seen in mice, and overall mice homozygous for the AU040320 mutation appear to be healthy, although there is some transient hairloss (alopecia). Previously it has been reported that male mice homozygous for a different AU040320 null mutation were sterile due to disruption of acrosome biogenesis on the C57BL/6J background (PMC6039479). This mutation also showed sterility in homozygous males, requiring maintenance of HET males for breeding. Females HOM are fertile. Homozygotes are resistant to AAV transduction. This strain may be useful in testing virus based gene therapies.

When combined with the SELECTIV mouse model (C57BL/6J-Igs2^{tm1(CAG-AU040320/mCherry,-cas9*)Janc}/J; Stock No. 037553), which allows cre-inducible overexpression of AAVR, SELECTIV-KO mice prevent transduction of all non-target cell types, thus improving AAV specificity.

Development

TALEN based genome editing used primer pairs 5'-TGGGAGTCAAGCCAAGTC-3' and 5'-GCCAGGATATTGTTGGCAGA-3' to cause a 1 bp deletion (T) in exon 2 of the AU040320 locus on chromosome 4 resulting in a frameshift. TALEN mRNAs were introduced by pronuclear injection into FVB/NCrl blastocysts. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to FVB/NCrl mice for germline transmission. Founders were sequenced to confirm the mutation(KO: tgggagtcaagccaagtcccgcttcc:gggttttgccaggatattg; WT: tgggagtcaagccaagtcccgcttccTgggttttgccaggatattg). Mice were then backcrossed to C57BL/6J for 12 generations. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J (Stock No. 000664) oocytes.

Allele

Symbol: AU040320^em1Janc
Name: endonuclease-mediated mutation 1, Jan Carette
MGI accession ID: MGI:5907241
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Aavr^-; Kiaa0319l^-
Marker symbol: AU040320
Marker name: expressed sequence AU040320
Marker synonyms: AAVR; AAVRL
Chromosome: 4
Strain of origin: FVB/N
Molecular note: The gene was targeted via TALEN technology using the primer pairs 5'-TGGGAGTCAAGCCAAGTC-3' and5'-GCCAGGATATTGTTGGCAGA-3'. This mutation comprises a single-nucleotide (T) deletion at position 264 of the 4379-nucleotide GenBank cDNA sequence BC028869.1, resulting in a reading-frame shift.