C57BL/6J-Ankrd26^em1Ahol/J

Stock number: 037529
Product name: Ankrd26^-
Strain synonyms: Ankrd26 KO
Research areas: Apoptosis Research, Cancer Research, Cell Biology Research

Description

Ankrd26^- mice carry a CRISPR/cas9 generated deletion of exons 23-30 of the ankyrin repeat domain 26 (Ankrd26) gene. These mice may be useful for studying the role of Ankrd26 in centriole signaling related to centrosome amplification and polyploidy. This is important in the context of cancer pathogenesis and chronic liver disease.

Detailed description

Centrosome overamplification occurs frequently in most cancers; typically cells with abnormal centrosomes are recognized and trigger activation of the PIDDosome complex resulting in cell death. This complex consists of caspase-2, (CASP2), p53-induced death domain protein 1 (PIDD1), and CASP2 and RIPK1 domain containing adaptor with death domain (CRADD). It has been determined that PIDDosome activation relies on ankyrin repeat domain 26 (ANKRD26)-dependent recruitment of PIDD1 in order to arrest growth of cells with extra centrosomes. ANKRD26 is a centriole distal appendage protein and contains ankyrin repeats and spectrin helices, which may serve to mediate protein-protein interactions. These Ankrd26^- mice possess a CRISPR/cas9 generated deletion of exons 23-30 of the Ankrd26 gene. This deletion results in a frameshift mutation causing premature termination and loss of the PIDD1 binding domain of ANKRD26.

Utilizing this mouse model, the donating laboratory found that Ankrd26^-/- mice demonstrated a significant increase in hepatocyte ploidy compared to wildtype mice, though overall liver size and function was not affected. However, after carbon tetrachloride (CCl₄)-induced liver damage, the Ankrd26^-/- mice showed significantly greater liver necrosis compared to CCl₄-exposed wildtype controls. Ankrd26^- homozygous mice are viable and fertile, though the donating investigator notes that the homozygous mice gain weight faster than their heterozygous and wildtype (WT) littermates. Homozygous mice also have smaller litter sizes and reduced productivity over 16 weeks of age, possibly due to obesity phenotype. This obesity phenotype is noted in other Ankrd26-deficient mouse models, as partial inactivation of ANKRD26 may be linked to enhanced adipogenesis.

These Ankrd26^- mice may be useful for studying regulation of PIDDosome activated cell cycle arrest or cell death in multiple cancers as well as in chronic liver disease.

Development

The Ankrd26^- allele was generated using CRISPR/cas9 endonuclease-mediated homology-directed repair (HDR) genome editing. Two guide RNAs (5’ sgRNA: 5’-gccacacatccagggtcgag and 3’ sgRNA: 5’-gaaagctgtggtattcacgc) and a single-stranded DNA were used to delete exons 23-30 of the Ankrd26 gene. Ankrd26 transcript Ankrd26-201 was used as reference for the exon number, and the guide and donor sequences. The sgRNAs, ssDNA, and cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted pups were identified by PCR. The resulting Ankrd26^-/+ mice were backcrossed to C57BL/6J mice for two generations to minimize off-target CRISPR effects by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664). Of note, the donating investigator indicated that the Y chromosome has been fixed to C57BL/6J background.

Allele

Symbol: Ankrd26^em1Ahol
Name: endonuclease-mediated mutation 1, Andrew Holland
MGI accession ID: MGI:7316648
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Ankrd26
Marker name: ankyrin repeat domain 26
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing uses two guide RNAs (gccacacatccagggtcgag and gaaagctgtggtattcacgc) and a single-stranded DNA to delete exons 23-30.