C57BL/6J-Arid5a^em1Gaff/J

Stock number: 037523
Product name: Arid5a^-
Research areas: Cell Biology Research, Immunology, Inflammation and Autoimmunity Research

Description

Arid5a^-/- knock-out mice carry a CRISPR/Cas9 generated deletion of a 3,359 bp region of the Arid5a gene containing exons 3-6 and part of exon 7. These mice are useful when studying signaling pathways critical in host defense and those required in autoimmunity.

Detailed description

ARID5A is a transcription factor and RNA binding protein that has been shown to regulate the development of inflammatory and autoimmune diseases. ARID5A controls inflammatory gene expression in macrophanges, T cells, and fibroblasts by post-transcriptional mechanisms including enhanced RNA stabilization and/or RNA translation. ARID5A is implicated in Th17 cell differentiation through control of STAT3 and IL-6 mRNA.

Arid5a^-/- knock-out mice carry a CRISPR/Cas9 generated deletion of a 3,359 bp region of the AT rich interactive domain 5A (MRF1-like) (Arid5a) gene containing exons 3-6 and part of exon 7.

These Arid5a^-/- mice exhibit resistance to the experimental autoimmune encephalomyelitis model of CNS inflammation. Mice are also resistant to oral and systemic Candida albicans fungal infections. These mice are useful when looking IL-17 or TLR4 signaling, and in differences between signaling pathways critical in host defense compared to those required in autoimmunity. Homozygous mice are viable and fertile.

Development

A sgRNAs (ATAGGCTCTGGCCTACAGTTTGG and GTAAAAGCCAAATGCGCCCCAGG) were designed to insert a loxP site in intron 2 and a Myc-tag at the C-terminal, with another loxP site, just after the stop codon of the AT rich interactive domain 5A (MRF1-like) (Arid5a) gene. A founder was identified carrying a deletion between the two SpyCas9 target sites, with a deletion of 3,359 bp deletion on chromosome 1 between position 36,316,840 and 36,320,199 (exons 3-6 and part of exon 7). sgRNAs, the Cas9 nuclease mRNA, and two single stranded oligonucleotides were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Arid5a^-/- pups were identified by PCR and sequencing and were further backcrossed to C57BL/6J mice for at least 1 generation by the donating laboratory. No off-target CRISPR sites were found. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Arid5a^em1Gaff
Name: endonuclease-mediated mutation 1, Sarah Gaffen
MGI accession ID: MGI:7334831
Generation method: Endonuclease-mediated
Attributes: Null/Knockout; Epitope tag
Marker symbol: Arid5a
Marker name: AT rich interactive domain 5A (MRF1-like)
Chromosome: 1
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing uses sgRNAs (ATAGGCTCTGGCCTACAGTTTGG and GTAAAAGCCAAATGCGCCCCAGG) to insert a loxP site in intron 2 and a Myc-tag at the C-terminal, with another loxP site, just after the stop codon. A founder was identified carrying a deletion between the two SpyCas9 target sites, with a deletion of 3,359 bp deletion on chromosome 1 between position 36,316,840 and 36,320,199 (exons 3-6 and part of exon 7).