FVB/NJ-Il4ra^em1Amen/J

Stock number: 037518
Product name: Il4ra KO
Research areas: Cancer Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools

Description

Il4ra knock-out (KO) mice carry a CRISPR/Cas9-made mutation that knocks out exon 4 of the interleukin 4 receptor, alpha (Il4ra) gene. These mice may be useful for studying regulation of type II inflammatory responses, wound healing, cell proliferation and metastasis in various cancers, as well as tumor-associated macrophage activation in multiple cancers.

Detailed description

The interleukin receptor 4, alpha gene (Il4ra) codes for the alpha subunit of the interleukin 4 transmembrane receptor (IL-4Rα). The IL-4Rα sub-unit binds to circulating interleukin 4 (IL-4) and interleukin 13 (IL-13) to regulate cellular functions of lymphocytes, myeloid cells, and non-hematopoietic cells. Specifically, the IL-4/IL-4Rα complex activates the differentiation of naïve CD4 T cells into T-helper 2 (Th) cells, drives the immunoglobulin (Ig) class switch to IgG1 and IgE in B cells and mediates alternative macrophage activation. These Il4ra knock-out mice carry a CRISPR/Cas9-made mutation that knocks out exon 4 of the Il4ra gene resulting in ablation of IL-4/IL-4Rα complex mediated signal transduction. Homozygous mice are viable and fertile, with no overt phenotype. These Il4ra KO mice may be useful for studying immune responses to inflammatory diseases as well as tumor-associated macrophage activation in multiple cancers.

Development

The Il4ra KO allele was generated using CRISPR/Cas9 endonuclease- genome editing at The Jackson Laboratory. Guide RNAs were selected to target upstream [CACCACGTTAAAGCACAGGG; GCTCCCACCACTAAGGTCAG] and downstream [GCTTGTGGCAGCTTACTGAG; GCTCAACTGTAGTATCACGC] of exon 4 of the interleukin 4 receptor, alpha (Il4ra) gene on Chromosome 7. Il4ra transcript Il4ra-201 was used as reference for the exon number and the guide sequences. These guide sequences and the Cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from FVB/NJ (Stock No. 001800) mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Il4ra KO mice were maintained on an FVB/NJ background to reduce off-target CRISPR changes. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize FVB/NJ oocytes.

Allele

Symbol: Il4ra^em1Amen
Name: endonuclease-mediated mutation 1, Sarah Amend
MGI accession ID: MGI:7334731
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Il4ra
Marker name: interleukin 4 receptor, alpha
Chromosome: 7
Strain of origin: FVB/NJ
Molecular note: CRISPR/cas9 genome editing uses guide RNAs to target upstream [CACCACGTTAAAGCACAGGG; GCTCCCACCACTAAGGTCAG] and downstream [GCTTGTGGCAGCTTACTGAG; GCTCAACTGTAGTATCACGC] of exon 4. Il4ra transcript Il4ra-201 was used as reference for the exon number and the guide sequences