C57BL/6J-Fmo3^em1Bdgr/J

Stock number: 037364
Product name: Fmo3^-
Research areas: Cardiovascular Research, Internal/Organ Research, Neurobiology Research, Research Tools

Description

Fmo3^-/- knock-out mice carry a CRISPR/Cas9 generated deletion of a 7-nucleotide region of the flavin containing monooxygenase 3 (Fmo3) gene, resulting in a frameshift mutation leading to a premature stop codon. These mice are useful when studying pathogenesis of the metabolic syndrome such as insulin resistance, cardiovascular disease, chronic kidney disease, and neurodegenerative disease.

Detailed description

Fmo3^-/- knock-out mice carry a CRISPR/Cas9 generated deletion of a 7-nucleotide region of the flavin containing monooxygenase 3 (Fmo3) gene, resulting in a frameshift mutation leading to a premature stop codon at residue 98. FMO3 is an essential hepatic drug-metabolizing enzyme that catalyzes the oxygenation of compounds containing nitrogen, sulfur, or phosphorus, including drugs as well as dietary compounds. One product of FMO3 is trimethylamine N-oxide (TMAO), generated from dietary factors, such as choline, which are converted by the gut microbes to trimethylamine (TMA), which is in turn converted to TMAO by FMO3. The expression of FMO3, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels may alter the rate at which xenobiotics are metabolized.

TMAO has been found to be increased in insulin-resistant mice, while plasma levels of TMAO in humans correlate with insulin resistance, diabetes, renal disease, and risk for cardiovascular disease. In mice, TMAO feeding promotes glucose intolerance, thrombosis, cardiovascular disease, chronic kidney disease, and neurodegenerative disease, whereas the reduction of TMAO prevents their development. Homozygous mice are viable and fertile.

Development

A sgRNA (TGGGAAAGTCATCGGGATAGGGG) was designed to delete a 7-nucleotide region of the flavin containing monooxygenase 3 (Fmo3) gene, resulting in a frameshift mutation leading to a premature stop codon. sgRNA and the Cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Fmo3^-/- pups were identified by PCR and sequencing and were further backcrossed to C57BL/6J mice for at least 6 generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

Allele

Symbol: Fmo3^em1Bdgr
Name: endonuclease-mediated mutation 1, Sudha Biddinger
MGI accession ID: MGI:7280707
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Fmo3
Marker name: flavin containing monooxygenase 3
Marker synonyms: dJ127D3.1; FMOII; TMAU
Chromosome: 1
Strain of origin: C57BL/6J
Molecular note: A sgRNA (TGGGAAAGTCATCGGGATAGGGG) is designed to delete a 7-nucleotide region of the gene resulting in a frameshift mutation leading to a premature stop codon.