C57BL/6J-Ddc^em2Gregg/BnthsJ

Stock number: 037362
Product name: Ddc^V5
Strain synonyms: Ddc-V5-P2A-mRuby2-3xNLS
Research areas: Neurobiology Research, Research Tools

Description

Ddc^V5 knock-in mice contain a CRISPR/cas9 generated insertion of a V5 epitope tag and the mRuby2 reporter sequence immediately before the stop codon of the dopa decarboxylase (Ddc). These mice use immunolabeling with an anti-V5 protein tag antibody to label cells for all major monoaminergic brain regions making them useful when studying brain-adrenal axis function and foraging. When bred to Ddc^eGFP mice (Stock No. 037361) cellular expression of the maternal versus paternal Ddc alleles may be dissected.

Detailed description

Ddc^V5 knock-in mice contain a CRISPR/cas9 generated insertion of a V5 epitope tag and the mRuby2 reporter sequence immediately before the stop codon of the dopa decarboxylase (Ddc) gene. Dopamine (DA) is essential in regulating the secretion and release of hormones that affect water and electrolyte balance, thus controlling food and water intake at the brain level and by controlling the transport of water and ions at the renal and gastrointestinal tract levels. DA in the central and peripheral neural systems has an established role in motor and behavior control. The kidney possesses an independent dopaminergic system distinct from the neural DA system. Ddc encodes an enzyme that localizes to renal proximal tubules and is responsible for intrarenal dopamine biosynthesis, as well as serotonin and tryptamine biosynthesis.

mRuby2 fluorescence is detectable by direct fluorescence in regions with high DDC expression like the ventral tegmental area (VTA). Immunolabeling of tissues from Ddc^V5 mice with an anti-V5 protein tag antibody labels cells for all major monoaminergic brain regions including preoptic area (POA), arcuate nucleus (ARN), VTA, dorsal raphe nucleus (DRN), and locus coeruleus (LC). Homozygous mice are viable and fertile.

When bred to Ddc^eGFP mice (Stock No. 037361) containing a nuclear EGFP reporter sequence immediately before the stop codon of the Ddc gene, cellular expression of the maternal versus paternal Ddc alleles may be dissected. The maternal alleles affect sons while daughters are under paternal allelic control in studies of naturalistic foraging. Also, the maternal Ddc allele is preferentially expressed in subsets of hypothalamic GABAergic neurons, while the paternal allele predominates in subsets of adrenal cells.

Development

A crRNA (AAUGAAAGCAGAGCUGCUUC) was designed to insert the Ddc40HA-V5-P2A-mRuby2-3xNLS (Ddc^V5) construct immediately before the stop codon of the dopa decarboxylase (Ddc) gene. Specifically, the construct contained (from 5’ to 3’) the last 40 bp of Ddc coding sequence c-terminally conjugated with a V5 epitope tag, P2A self-cleaving peptide sequence, mRuby2 conjugated with three c-terminal copies of a nuclear localization sequence (3xNLS), stop codon, 37 bp of mutated Ddc 3’-UTR (mUTR) to prevent homology repair between the stop codon and a CRISPR cut site 34 bp downstream (preserving the 3’-splice junction of exon 14), followed by 40 bp of un-mutated Ddc intron 14 sequence. The crRNA, donor plasmid, and the cas9 nuclease were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well recognized pronuclei. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by sequencing and PCR and resulting Ddc^V5 mice were backcrossed to C57BL/6J mice (Stock No. 000664) for at least 5 generations to remove off-target CRISPR changes. Sanger sequencing confirmed that the reporter was in-frame with the Ddc coding sequence, contained no indels, and no non-synonymous amino acid substitutions. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Ddc^em2Gregg
Name: endonuclease-mediated mutation 2, Christopher Gregg
MGI accession ID: MGI:7266270
Generation method: Endonuclease-mediated
Attributes: Reporter; Epitope tag
Synonyms: Ddc^V5
Marker symbol: Ddc
Marker name: dopa decarboxylase
Marker synonyms: AADC; aromatic L-amino acid decarboxylase
Chromosome: 11
Strain of origin: C57BL/6J
Molecular note: A crRNA (AAUGAAAGCAGAGCUGCUUC) was designed to insert the Ddc40HA-V5-P2A-mRuby2-3xNLS construct immediately before the stop codon of the gene. Specifically, the construct contained (from 5'; to 3') the last 40 bp of Ddc coding sequence c-terminally conjugated with a V5 epitope tag, P2A self-cleaving peptide sequence, mRuby2 conjugated with three c-terminal copies of a nuclear localization sequence (3xNLS), stop codon, 37 bp of mutated Ddc 3'-UTR (mUTR) to prevent homology repair between the stop codon and a CRISPR cut site 34 bp downstream (preserving the 3';-splice junction of exon 14), followed by 40 bp of un-mutated Ddc intron 14 sequence.