B6.Cg-Rxfp1^em1(cre)Ngai/TasicJ

Stock number: 037336
Product name: Rxfp1-P2A-Cre
Research areas: Neurobiology Research, Research Tools

Description

Rxfp1-P2A-Cre knock-in mice are designed to have Cre recombinase expression/activity directed by the endogenous relaxin/insulin-like family peptide receptor 1 promoter/enhancer sequences. These mice may be used to generate conditional mutations for studying function of Rxfp1-expressing cells.

Detailed description

The Rxfp1 gene codes for relaxin/insulin-like family peptide receptor 1 (Rxfp1), a member of the seven‐transmembrane G‐protein‐coupled receptor family (RXFP1). Rxfp1 is highly expressed in multiple tissues. The hormone Relaxin is the primary ligand for RXFP1; the Relaxin/RXFP1 complex has been implicated in regulation of collagen metabolism, fibrosis, and vasodilation. The Relxin/RXFP1 system may also play a role in regulation of thirst, osmotic homeostasis, somatosensory system and cognition.

The Rxfp1-P2A-Cre knock-in mutation has a P2A sequence and a Cre recombinase gene inserted immediately at the Rxfp1 translational STOP codon - this is designed to have the endogenous promoter/enhancer elements direct cre expression to Rxfp1+ cells. When Rxfp1-P2A-Cre mice are bred with mice containing lox-flanked sequences, Cre-mediated recombination will result in deletion of the floxed sequences in Rxfp1-expressing cells in the offspring.

The donating investigator reports Cre recombinase expression/activity largely recapitulates the endogenous Rxfp1 gene expression in the brain. They did not examine cre expression in tissues other than brain. This knock-in allele is designed to avoid disrupting expression of the endogenous protein, although Rxfp1 expression from the Rxfp1-P2A-Cre allele has not been evaluated to date (May 2022). Heterozygous mice are viable and fertile with no reported gross physical or behavioral abnormalities. To date (May 2022), it has not been attempted to make this strain homozygous.

Development

The Rxfp1-P2A-Cre allele was generated using CRISPR/Cas9 endonuclease-mediated homology-directed repair (HDR) genome editing by the laboratory of Dr. John Ngai (University of California, Berkeley). The specific details are below.

First, a ribonucleoprotein complex (cas9-RNP) was created consisting of the CRISPR/Cas9 nuclease fused to a guide RNA sequence [ACTCAATTCTTATTCGTAAC] designed to target the STOP codon of the relaxin/insulin-like family peptide receptor 1 gene (Rxfp1) on chromosome 3. The cas9-RNP complex, a P2A-Cre dsDNA (encoding a viral 2A oligopeptide that mediates ribosomal skipping and a codon-optimized cre gene),and a Myc-tag with Rxfp1 homology arms were injected into (C57BL/6 x 129S4/SvJae)F1-derived v6.5 embryonic stem (ES) cells. Chimeric mice were generated by aggregating ES cells with morula-stage embryos, and chimeras were reported to have been bred to C57BL/6J (Stock No. 000664) mice to achieve germline transmission. The donating investigator reports the resulting Rxfp1-P2A-Cre colony was further bred to C57BL/6J for 5 generations.

Of note, the donating investigator reports that, at least once during backcrossing, a Rxfp1-P2A-Cre female was bred to a C57BL/6J inbred male (thus the Y chromosome of the congenic strain is of C57BL/6J origin).

Allele

Symbol: Rxfp1^em1(cre)Ngai
Name: endonuclease-mediated mutation 1, John Ngai
MGI accession ID: MGI:6502651
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Marker symbol: Rxfp1
Marker name: relaxin/insulin-like family peptide receptor 1
Chromosome: 3
Strain of origin: (C57BL/6 x 129S4/SvJae)F1
Molecular note: The bicistronic Rxfp1-P2A-Cre knock-in allele was created using homologous recombination (aided by targeted CRISPR/cas9 endonuclease activity) to insert a viral 2A oligopeptide sequence (T2A; mediates ribosomal skipping) and a Cre recombinase gene (cre) the gene. The targeting vector, Cas9 endonuclease, and guide-RNA were mixed and injected into the v6.5 mouse embryonic stem cells. Colonies grown from transfected cells were directly screened for successful integration and were aggregated with albino morula and implanted into pseudopregnant females, which produced germ-line-competent chimeric founders.