NOD.Cg-Rag2^em8Lutzy Il2rg^tm1Wjl/J

Stock number: 037276
Product name: Rag2^delEx3 IL2Rγ^null
Strain synonyms: NRG2
Research areas: Cancer Research, Developmental Biology Research, Immunology, Inflammation and Autoimmunity Research

Description

These Rag2^delEx3 IL2Rγ^null mice contain a knock-out of the Rag2 gene from Stock No. 033537 and a knockout of the X-linked Il2rg gene from Stock No. 003174. These mice may be useful in studying B and T cell deficiency as well as for xenograft/transplantation.

Detailed description

The recombination activating gene 2 gene (Rag2) encodes a protein that is part of the multiprotein RAG complex which is involved in V(D)J recombination. Mutations in this gene have been useful to study immune deficiency, cancer, toxicology and xenograft/transplant research.

To create the Rag2 KO allele, Rag2^delEx3, CRISPR/Cas9 endonuclease-mediated genome editing of Rag2 exon3 was used to create a complete loss of exon 3. Some of these mice were further bred to NSG mice (Stock No. 005557) and the Prkdc^scid mutation was removed.

If additional characterization of these Rag2^delEx3 IL2Rγ^null mice is performed, we may modify the strain description accordingly.

Females homozygous for both the Rag2^delEx3 and Il2rg^tm1Wjl alleles and males homozygous for Rag2^delEx3 and hemizygous for the X-linked Il2rg^tm1Wjl allele are viable and fertile.

Development

The Rag2 KO allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs were selected to target upstream [AGCCAGTCCGCCACTAAAAT ; GACCTATTTTAGTGGCGGAC] and downstream [CCCCCCGGTTACTTGTGATT ; CACCTAATCACAAGTAACCG] of exon3 of the recombination activating gene 2 locus (Rag2) on Chromosome 2. Donor DNAs were created. Rag2 transcript Rag2-201 was used as reference for the exon numbering and the guide/donor sequences. These sequences and Cas9 nuclease were introduced into NOD/ShiLtJ zygotes, and then transferred to pseudopregnant females. Progeny were screened by DNA sequencing of the targeted region, which identified founder 3628 harboring a complete loss of exon 3. Rag2 KO mice, also called Rag2^delEx3, are available as (Stock No. 033537).

Some of these mice were further crossed to NSG mice (Stock No. 005557), and subsequently, resulting mice were bred together to remove the Prkdc^scid mutation. This new strain, containing the Rag2^delEx3 and Il2rg^tm1Wjl alleles are maintained on an NOD/ShiLtJ congenic background, is available as this Stock No. 037276.

Allele

Symbol: Rag2^em8Lutzy
Name: endonuclease-mediated mutation 8, Cathy Lutz
MGI accession ID: MGI:6877076
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Rag2
Marker name: recombination activating gene 2
Marker synonyms: Rag-2
Chromosome: 2
Strain of origin: NOD/ShiLtJ
Molecular note: CRISPR/cas9 genome editing is used to delete exon 3, Guide RNAs were selected to target upstream [AGCCAGTCCGCCACTAAAAT ; GACCTATTTTAGTGGCGGAC] and downstream [CCCCCCGGTTACTTGTGATT ; CACCTAATCACAAGTAACCG] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified founder 3628 harboring a complete loss of exon 3.

Allele

Symbol: Il2rg^tm1Wjl
Name: targeted mutation 1, Warren J Leonard
MGI accession ID: MGI:1857455
Generation method: Targeted
Attributes: Null/Knockout
Synonyms: [KO]gammac; CD132^-; gammac^-; gc^-; Il2rg^tm1Wjll; IL2Rgamma^null
Marker symbol: Il2rg
Marker name: interleukin 2 receptor, gamma chain
Marker synonyms: [g]c; Ab2-183; Cd132; CIDX; common cytokine receptor gamma chain; common gamma chain; gamma C receptor; gamma(c); gammaC; gc; IL-2RG; IMD4; P64; SCIDX; SCIDX1
Chromosome: X
Strain of origin: 129S4/SvJae
Site of expression: Primarily lymphoid cells.
Molecular note: A neomycin resistance cassette replaced part of exon 3 and all of exons 4 - 8 of the gene, resulting in the loss of most of the extracellular domain and all of the transmembrane and cytoplasmic domains of the protein.