NOD.Cg-Rag2^em8Lutzy H2-K1^b-tm1Bpe H2-Ab1^g7-em1Mvw H2-D1^b-tm1Bpe Il2rg^tm1Wjl/J

Stock number: 037275
Product name: NRG-DKO , NRG-MHC I/II DKO
Strain synonyms: NRG-DKO
Research areas: Cancer Research, Diabetes and Obesity Research, Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Removal of this mouse colony is imminent. If live mice are needed for your studies, it is advised that they be ordered immediately. After removal, the mice will be available from a cryorecovery.

NRG-MHC I/II DKO mutant mice combine the features of the recombination activating 2 gene (Rag2) null mutation, IL2 receptor gamma chain deficiency (Il2rg), MHC class I molecule deficiency (H2-K and D), and MHC class II molecule deficiency (IA) and exhibit a resistance to graft versus host disease (GVHD). They provide a model useful to study in vivo mechanisms of xenogeneic GVHD and to rapidly assess therapeutic agents.

Detailed description

NRG-MHC I/II DKO mice are NOD.Rag2;IL2rg-deficient (NRG) animals containg the null targeted mutations for mouse MHC class I genes (H2-K1 and H2-D1) and a TALEN-made null mutation for the mouse class II gene (H2-Ab1 [I-A]) - making them an MHC I/II double knock-out.

These NRG-MHC I/II DKO mice combine the features of the recombination activating 2 gene (Rag2) null  (exon 3 deleted using CRISPR/cas9) mutation(B and T cell deficiency), IL2 receptor gamma chain deficiency (NK cell deficiency), MHC class I molecule deficiency (H2-K and D), and MHC class II molecule deficiency (IA). Mice homozygous for the five mutations are viable, normal in size and do not display any gross physical or behavioral abnormalities. Because this strain carries a null mutation in the MHC class I H2-Ab1 gene rather than β-2M, IgG clearance may be to that observed in the NSG model. This strain may be useful to study human immunity in the absence of GVHD and to evaluate antibody-based therapeutics.

Development

To create the NRG-MHC I/II DKO mice, mice carrying the CRISPR/cas9 generated Rag2 exon 3-deleted KO (NOD/ShiLtJ-Rag2^em8Lutzy/J, Stock No. 033537), were crossed to NOD.Cg-Prkdc^scid H2-K1^tm1Bpe H2-Ab1^em1Mvw H2-D1^tm1Bpe Il2rg^tm1Wjl/SzJ (Stock No. 025216) and the Prkdc^scid mutation bred out.

Allele

Symbol: H2-Ab1^g7-em1Mvw
Name: endonuclease-mediated mutation 1, Michael Wiles
MGI accession ID: MGI:6156109
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-Ab1^em1Mvw; IA^null
Marker symbol: H2-Ab1
Marker name: histocompatibility 2, class II antigen A, beta 1
Marker synonyms: A beta; Abeta; Bb; CELIAC1; DQB2; H-2Ab; H2-Ab; HLA-DQB; HLA-DQB1; HLA-DXB; I-A^b; Ia2; Ia-2; IAb; I-Abeta; IDDM1; Rmcs1; RT1.B
Chromosome: 17
Strain of origin: NOD.Cg-Prkdc^scid H2-K1^b-tm1Bpe H2-D1^b-tm1Bpe Il2rg^tm1Wjl/Sz
Molecular note: This TALEN-mediated null mutation has a 61 bp deletion in exon 2, Chr 17: :34264928-34264988 (GRCm38), followed by 39 bp of retained endogenous sequence, then a 507 bp deletion, Chr 17: 34265028-34265534, with a 7 bp insertion (CCGTCAC) in its place, the impact of which is a disruption of most of exon 2. Flow cytometric analysis confirmed this to be a null allele.

Allele

Symbol: H2-K1^b-tm1Bpe
Name: targeted mutation 1, Beatrice Perarnau
MGI accession ID: MGI:1931444
Generation method: Targeted
Attributes: Null/Knockout
Synonyms: H2-K^b-; H-2K^o; H2-K1^tm1Bpe; K^-; K^b-
Marker symbol: H2-K1
Marker name: histocompatibility 2, K1, K region
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2K; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: 129P2/OlaHsd
Molecular note: The central part of the H2-K gene, including the second and third exons was replaced by a HPRT minigene.

Allele

Symbol: Rag2^em8Lutzy
Name: endonuclease-mediated mutation 8, Cathy Lutz
MGI accession ID: MGI:6877076
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Rag2
Marker name: recombination activating gene 2
Marker synonyms: Rag-2
Chromosome: 2
Strain of origin: NOD/ShiLtJ
Molecular note: CRISPR/cas9 genome editing is used to delete exon 3, Guide RNAs were selected to target upstream [AGCCAGTCCGCCACTAAAAT ; GACCTATTTTAGTGGCGGAC] and downstream [CCCCCCGGTTACTTGTGATT ; CACCTAATCACAAGTAACCG] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified founder 3628 harboring a complete loss of exon 3.

Allele

Symbol: Il2rg^tm1Wjl
Name: targeted mutation 1, Warren J Leonard
MGI accession ID: MGI:1857455
Generation method: Targeted
Attributes: Null/Knockout
Synonyms: [KO]gammac; CD132^-; gammac^-; gc^-; Il2rg^tm1Wjll; IL2Rgamma^null
Marker symbol: Il2rg
Marker name: interleukin 2 receptor, gamma chain
Marker synonyms: [g]c; Ab2-183; Cd132; CIDX; common cytokine receptor gamma chain; common gamma chain; gamma C receptor; gamma(c); gammaC; gc; IL-2RG; IMD4; P64; SCIDX; SCIDX1
Chromosome: X
Strain of origin: 129S4/SvJae
Site of expression: Primarily lymphoid cells.
Molecular note: A neomycin resistance cassette replaced part of exon 3 and all of exons 4 - 8 of the gene, resulting in the loss of most of the extracellular domain and all of the transmembrane and cytoplasmic domains of the protein.

Allele

Symbol: H2-D1^b-tm1Bpe
Name: targeted mutation 1, Beatrice Perarnau
MGI accession ID: MGI:1931445
Generation method: Targeted
Attributes: Null/Knockout
Synonyms: D^-; D^b-; H-2 D^bo; H-2D^b-; H-2D^b knockout; H-2D^o; H2-D1^tm1Bpe; HHD
Marker symbol: H2-D1
Marker name: histocompatibility 2, D region locus 1
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2D; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A2(N); RT1.Cg; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E2; RT1-CE12; RT1-Uav1; RT1-Uc; RT1-Ulv1
Chromosome: 17
Strain of origin: 129P2/OlaHsd
Molecular note: Exons 1, 2 and 3 of the b haplotype gene were replaced with plasmid sequences and a neomycin cassette.