C57BL/6-Lrrk2^em1Yue/J

Stock number: 037193
Product name: Lrrk2^N2081D KI
Research areas: Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Neurobiology Research

Description

Lrrk2^N2081D knock-in mice express a conserved N2081D LRRK2 (leucine rich repeat kinase 2) variant associated with Crohn's disease (CD). Homozygotes show increased sensitivity to chemically-induced colitis.

Detailed description

LRRK2 (leucine rich repeat kinase 2) protein contains a kinase domain where both the N2081D Crohn's disease (CD) risk and the G2019S Parkinson's disease (PD)-pathogenic variants are located.

Lrrk2^N2081D knock-in mice express the conserved N2081D LRRK2 variant, which is expressed at endogenous levels. Homozygotes show increased sensitivity to chemically-induced colitis. No pathological phenotype has been observed in untreated mice, however there is an increase in phosphorylated RAB10 (RAB10, member RAS oncogene family) protein levels in the tissues of these mice compared to wildtype. Rab10 encodes a key substrate for LRRK2.

Colitis is induced by administering 2% dextran sodium sulfate (DSS) in the drinking water of 16-week-old homozygous male and female mice for 8 days, followed by 3 days of regular water for partial recovery. In both sexes, homozygous mice exhibit more severe weight loss compared to wildtype animals. A significant number of males require early sacrifice due to the severity of colitis symptoms. At the experimental end point, both male and female mice have shorter colons than their sex-matched wildtype counterparts, indicating a greater degree of colonic inflammation. Stool samples extracted from colons of N2081D mutation carriers have significantly higher levels of the proinflammatory marker lipocalin-2 (LCN2). Male N2081D carriers also have increased spleen weight compared to wildtype mice, suggesting a heightened immune response. Histological examination of colon samples reveals a greater degree of inflammation and tissue damage in both male and female Lrrk2^N2081D carriers compared to sex-matched wildtype mice. Collectively, results show that the Lrrk2^N2081D mutation significantly exacerbates colonic inflammation and the severity of induced colitis, validating the Lrrk2^N2081D model as a tool to study Lrrk2-linked Crohn's disease pathogenic mechanisms.

Studies suggest that the N2081D mutation activates LRRK2 by inducing a conformational shift, resulting in functional effects distinct from the Parkinson's disease-associated LRRK2 G2019S variant.

Development

An LRRK2 N2081D missense mutation (AAT->GAT) (conserved in both mouse and human) and a silent downstream mutation in an EcoRI site (GAGTTT->GAATTC) were introduced to exon 41 of the mouse Lrrk2 gene using CRISPR/Cas9 methodologies. Single-stranded donor DNA was co-microinjected with gRNA (GCTAACTCATCAAACTCATTGG) and Cas9 protein into the pronuclei of C57BL/6J zygotes. The donating laboratory reported the resultant mice were backcrossed to C57BL/6J for approximately 3 or 4 generations to help remove any off-target mutations prior to sending heterozygous males to The Jackson Laboratory in 2025 (see SNP note and miniMUGA results below). Upon arrival, sperm was cryopreserved. Cryorecovery/live colony development will involve C57BL/6J (Stock No. 000664).

In 2025, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. One of the 5 markers that determine C57BL/6J from C57BL/6N was found to be segregating, the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

In 2025, the heterozygous males sent to The Jackson Laboratory were used to freeze sperm. Samples from those males were analyzed via the miniMUGA 10,000 SNP panel. This showed more than 99% of the markers as C57BL/6J and/or C57BL/6N. Additionally, 4 regions were identified having markers other than C57BL/6 present: Chromosome 3 ~52.76-53.52 Mb, Chromosome 3 ~53.88-56.82 Mb, Chromosome 12 ~73.63-87.89 Mb and Chromosome 19 ~59.11-59.53 Mb. These data suggest the mice sent to The Jackson Laboratory Repository were C57BL/6-congenic (mixed C57BL/6N;C57BL/6J genetic background).

Allele

Symbol: Lrrk2^em1Yue
Name: endonuclease-mediated mutation 1, Zhenyu Yue
MGI accession ID: MGI:7737634
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: LRRK2^N2081D
Marker symbol: Lrrk2
Marker name: leucine-rich repeat kinase 2
Marker synonyms: 4921513O20Rik; 9330188B09Rik; AURA17; cI-46; D630001M17Rik; DARDARIN; LOC381026; PARK8; RIPK7; ROCO2
Chromosome: 15
Strain of origin: C57BL/6J
Molecular note: A missense mutation (AAT->GAT) (conserved in both mouse and human) and a silent downstream mutation in an EcoRI site (GAGTTT->GAATTC) were introduced to exon 41 of the mouse Lrrk2 gene using CRISPR/Cas9 methodologies.