C57BL/6-Cd40^em1Vic Cd40lg^em2(srta)Vic/J

Stock number: 037113
Product name: Cd40^G5 Cd40lg^SrtAv2
Strain synonyms: LIPSTIC
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Cd40^G5 Cd40lg^SrtAv2 mice carry CRISPR/Cas9 generated G5 and SrtA tags at the N-terminal and C-terminal of each gene, respectively. These mice are useful for the identification of 'kiss-and-run' receptor-ligand interactions between immune cells using the "LIPSTIC" (Labelling Immune Partnerships by SorTagging Intercellular Contacts) approach.

Of note, a similar universal "uLIPSTIC" mouse line that is useful for tracking the interaction between immune cells and between immune and non-immune populations, irrespective of the receptors and ligands, is available as Stock No. 038221.

Detailed description

Cd40^G5 Cd40lg^SrtAv2 mice carry CRISPR/Cas9 generated G5 tag (five N-terminal glycine residues) and Staphylococcus aureus transpeptidase sortase A (SrtA) tag at the N-terminal and C-terminal of the CD40 receptor and CD40 ligand genes, respectively. Insertion of the tags do not disrupt endogenous gene expression, function, or regulation. These mice are useful for the identification of 'kiss-and-run' receptor-ligand interactions between immune cells using the "LIPSTIC" (Labelling Immune Partnerships by SorTagging Intercellular Contacts) approach.

When the CD40 ligand and CD40 receptor interact, SrtA catalyses the transfer of an introduced biotin substrate onto the G5-tagged receptor. After cells separate, the interaction history is revealed by the presence of the biotin label on the surface of the G5-expressing cell.

When crossed to OT-II TCR mice, expressing a T-cell receptor specific for the chicken ovalbumin (OVA) peptide (see Stock No. 004194) to test the model, by T cell priming with OVA and priming with a biotinylated substrate, CD40L-SrtA expression on T cells and interactions between dendritic cells and CD4+ T cells during T-cell priming in vivo can be traced by flow cytometry.

Double homozygous females and males homozygous for Cd40^G5 and hemizygous for Cd40lg^SrtAv2 are viable and fertile, and indistinguishable from wildtype littermates.

A similar universal "uLIPSTIC" mouse line that is useful for tracking the interaction between immune cells and between immune and non-immune populations, irrespective of the receptors and ligands, is available as Stock No. 038221.

Development

The Cd40^G5 Cd40lg^SrtAv2 mouse line was created by the laboratory of Dr. Gabriel D. Victora (The Rockefeller University).

To create Cd40^G5 mice, an sgRNA (CGCTGTTAATACGACTCACTATAGGTCTGTTTTTAGGTCCATCTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT) was designed to insert a G5 tag (five N-terminal glycine residues) fused at the 5' end of the CD40 antigen (Cd40) gene. The sgRNA, donor ssDNA template (TGGCTGGCACAAATCACAGCACTGGCCATCGTGGAGGTACTGTTTGTCACTGCACGTAACGGTACCTCCTCCGCCTCCACACTGCCCTAGATGTACCTAAAAACAGAAGTGGACAGCTGGAAGGGATCTTCCACCGGC), and Cas9 nuclease protein were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Resulting Cd40^G5 pups were identified by PCR and Sanger sequencing and were further backcrossed to C57BL/6J mice (Stock No. 000664) for at least 5 generations.

To create Cd40lg^SrtAv2 mice, another sgRNA (GAGTTGGCTTCTCATCTTT) was designed to insert a Staphylococcus aureus transpeptidase sortase A (SrtA) tag fused at the 3' end of the X-linked CD40 ligand (Cd40lg) gene. The sgRNA, donor ssDNA template, and the Cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6J mice with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Resulting Cd40lg^SrtAv2 pups were identified by PCR and Sanger sequencing and were further backcrossed to C57BL/6J mice for at least 5 generations.

Cd40^G5 mice were bred to Cd40lg^SrtAv2 mice and were maintained on a C57BL/6J genetic background by the donating investigator (see SNP note below). No off-target CRISPR sites are present. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

A 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Three of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Cd40lg^em2(srta)Vic
Name: endonuclease-mediated mutation 2, Gabriel Victora
MGI accession ID: MGI:7414033
Generation method: Endonuclease-mediated
Attributes: Epitope tag
Synonyms: Cd40lg^SrtA2
Marker symbol: Cd40lg
Marker name: CD40 ligand
Marker synonyms: CD154; Cd40L; gp39; hCD40L; HIGM1; IGM; IMD3; Ly-62; T-BAM; Tnfsf5; TRAP
Chromosome: X
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing is used sgRNA (GAGTTGGCTTCTCATCTTT) designed to insert a Staphylococcus aureus transpeptidase sortase A (SrtA) tag fused at the 3' end of the gene.

Allele

Symbol: Cd40^em1Vic
Name: endonuclease-mediated mutation 1, Gabriel Victora
MGI accession ID: MGI:6695966
Generation method: Endonuclease-mediated
Attributes: Epitope tag
Synonyms: Cd40^G5
Marker symbol: Cd40
Marker name: CD40 antigen
Marker synonyms: Bp50; CDW40; p50; Tnfrsf5
Chromosome: 2
Strain of origin: C57BL/6
Molecular note: CRISPR-targeting inserted into exon 2 a G5 tag (five N-terminal glycine residues).