B6.Cg-Atoh1^{em1(cre)Zyliu}/J

Stock number: 037103
Product name: Atoh1^3*HA-P2A-Cre
Research areas: Neurobiology Research, Research Tools, Sensorineural Research

Description

Atoh1^3*HA-P2A-Cre knock-in mice carry a CRISPR/Cas9 generated insertion of three HA tags and Cre recombinase just upstream of the stop codon of the Atoh1 gene. These mice are useful for lineage tracing, cell sorting, and gene manipulation of multiple cell types including cochlear hair cells (HCs).

Detailed description

Atoh1^3*HA-P2A-Cre knock-in mice carry a CRISPR/Cas9 generated insertion of three HA tags and Cre recombinase just upstream of the stop codon of the atonal bHLH transcription factor 1 (Atoh1) gene. Atoh1 encodes a transcription factor that plays a role in the differentiation of subsets of neural cells, such as cochlear hair cells (HCs), the dorsal spinal cord, brainstem, cerebellum, and intestinal secretory cells. Homozygotes are viable and fertile. When bred with mice containing loxP-flanked sequences, Cre-mediated recombination will result in deletion of the floxed sequences in the Cre-expressing cochlear HCs and nearby supporting cells of the offspring. Cochlear HCs in Atoh1^{3*HA-P2A-Cre/3*HA-P2A-Cre} mice are normal to at least P42, and auditory brainstem response (ABR) measurements reveal no significant differences. These mice do not suffer from adult-onset deafness as seen in other heterozygous Atoh1 knock-out mice.

Development

Guide RNA (CGCGCGCTAGGAAGGGCATT) was designed to insert three hemagglutinin (HA) tags, a P2A ribosomal skip cleavage peptide sequence, and a Cre recombinase immediately before the stop codon of the atonal bHLH transcription factor 1 (Atoh1) gene. The guide RNA, donor DNA, and the cas9 nuclease mRNA were introduced into the cytoplasm of fertilized eggs with well recognized pronuclei from hybrid C57BL/6 x DBA/2J mice. Targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and Southern blot confirmed the absence of random insertions. Resulting Atoh1^3*HA-P2A-Cre mice were further backcrossed to C57BL/6NCrl mice for at least 5 generations by the donating laboratory (see SNP note below). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2022, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Four of the five of the markers that determine C57BL/6J from C57BL/6N were found to be B6J-like, including the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Atoh1^{em1(cre)Zyliu}
Name: endonuclease-mediated mutation 1, Zhiyong Liu
MGI accession ID: MGI:6856836
Generation method: Endonuclease-mediated
Attributes: Recombinase-expressing
Synonyms: Atoh1^3*HA-P2A-Cre
Marker symbol: Atoh1
Marker name: atonal bHLH transcription factor 1
Marker synonyms: ATH1; bHLHa14; DFNA89; HATH1; Math1; MATH-1; RGD1565171
Chromosome: 6
Strain of origin: C57BL/6 x DBA/2
Molecular note: Using CRISPR/Cas9 technology, three hemagglutinin (HA) tags, a P2A ribosomal skip cleavage peptide sequence, and a cre recombinase were inserted immediately before the stop codon of the atonal bHLH transcription factor 1 (Atoh1) gene.