C57BL/6-Ghr^em1Liang/J

Stock number: 036972
Product name: Ghr^f
Research areas: Developmental Biology Research, Internal/Organ Research, Metabolism Research, Research Tools

Description

Ghr^f/f floxed mice carry a CRISPR/Cas9 generated mutation resulting in loxP sites flanking exons 4a and 4b of the growth hormone receptor (Ghr). This strain may be useful for studying feeding behavior, energy balance, and glucose metabolism.

Detailed description

Ghr^f/f floxed mice carry a CRISPR/Cas9 generated mutation resulting in loxP sites flanking exons 4a and 4b of the growth hormone receptor (Ghr). GHR encodes a type 1 cytokine receptor that binds to growth hormone and is involved in the regulation of feeding behavior, energy balance, and glucose metabolism.

Mice that are homozygous for this allele are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exons 4a and 4b removed in the Cre-expressing tissues of the offspring.

When Ghr^f/f mice are bred with Alb-Cre mice (Stock No. 005304), expressing Cre recombinase in the liver, resulting L-Ghr^−/− mice contain a frameshift, eliminating 93% of the amino acids in the GHR, abolishing protein function. These mice develop hypoglycemia and a drop in hepatic triglycerides when subjected to calorie restriction and then fasted for 23 hours. Hypoglycemia can be prevented by injection of lactate or octanoate to support gluconeogenesis. Extensive autophagy is evident in livers of calorie-restricted control mice but not in L-Ghr^−/− mice.

Development

Guide RNAs (TACAAGTGGGAATTAATCTG and ACCCATCTTCTAGTTATGAA) and oligo donor DNAs were designed to introduce a loxP sites flanking exons 4a and 4b of the growth hormone receptor (Ghr) gene. Guide RNAs, donor DNAs, and Cas9 nuclease mRNA were introduced into the cytoplasm of C57BL/6NCrl-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. One resulting Ghr^f founder male was identified by PCR and sequencing and was bred to C57BL/6NCrl females. Offspring were maintained on the C57BL/6NCrl background by the donating laboratory (see SNP note below). Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6NJ oocytes (Stock No. 005304).

In 2022, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. All 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a C57BL/6J genetic background.

Allele

Symbol: Ghr^em1Liang
Name: endonuclease-mediated mutation 1, Gousheng Liang
MGI accession ID: MGI:6830928
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Ghr^f
Marker symbol: Ghr
Marker name: growth hormone receptor
Marker synonyms: GHBP; GHIP; GHR/BP
Chromosome: 15
Strain of origin: C57BL/6NCrl
Molecular note: Using CRISPR/cas9 genome editing, guide RNAs (TACAAGTGGGAATTAATCTG and ACCCATCTTCTAGTTATGAA) and oligo donor DNAs are designed to introduce a loxP sites flanking exons 4a and 4b.