STOCK Col3a1^em2Hcd/J

Stock number: 036930
Product name: Col3a1^G938D
Research areas: Cardiovascular Research, Dermatology Research, Developmental Biology Research

Description

The Jackson Laboratory is unable to ship this strain as live mice due to its severe phenotype. Please contact Customer Service for availability of frozen material.

Col3a1^G938D mice carry a glycine to aspartic acid (G938D) substitution at the end of the triple helical collagenous domain of the mouse Col3a1 (collagen type III alpha 1 chain) gene. This mutation is analogous to one found in human patients. Heterozygotes recapitulate Vascular Ehlers-Danlos syndrome (vEDS) vascular phenotypes with sudden death due to aortic rupture. The reported median survival time is 45 days. Homozygotes are not viable.

Detailed description

Vascular Ehlers-Danlos syndrome (vEDS) is an autosomal-dominant connective tissue disorder caused by heterozygous mutations in the COL3A1 (collagen type III alpha 1 chain) gene. Patients with vEDS present with thin, translucent skin, easy bruising, and a characteristic facial appearance. Most critically, they are at risk for spontaneous rupture of the major arteries, hollow organs, and gravid uterus.

Col3a1^G938D mice carry a glycine to aspartic acid (G938D) substitution at the end of the triple helical collagenous domain of the mouse Col3a1 gene. This mutation is analogous to one found in human patients. Heterozygotes recapitulate vEDS vascular phenotypes with sudden death due to spontaneous aortic rupture at an average of 45 days of age. There is also an increased risk of vascular rupture with pregnancy. The mice have thin skin that tears easily and have poor wound healing. Homozygotes are not viable.

Col3a1^G209S heterozygous mice (Stock No. 036931), with a median survival of 400 days, display a less severe phenotype than heterozygous Col3a1^G938D mice (Stock No. 036930), surviving only 45 days.

Due to the delicate condition of the mice, cryopreserved stocks are available for shipment.

Development

CRISPR/Cas9 guide RNA sequences (AGTGGTGCTCCTGGCAAGGA and ACAGCAATAGCTCTCACCGG) targeted to exon 39 of the mouse Col3a1 gene (NC_000067.6) were used to introduce a glycine to aspartic acid substitution in amino acid 938 (G938D; nucleotide change GGT->GAT). The mutation was created in C57BL/6J embryos. This strain backcrossed to C57BL/6J for more than 7 generations to help remove any off-target mutations by the donating laboratory (see SNP note below).

Upon arrival at The Jackson Laboratory, sperm was cryopreserved. Maintenance of this stock will involve C57BL/6J (Stock No. 000664).

In 2021, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. Many of the 43 markers throughout the genome were segregating with an unknown source, suggesting an incomplete backcross.

Allele

Symbol: Col3a1^em2Hcd
Name: endonuclease-mediated mutation 2, Harry C Dietz
MGI accession ID: MGI:6790425
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: Col3a1^C938D
Marker symbol: Col3a1
Marker name: collagen, type III, alpha 1
Marker synonyms: Col3a-1; EDS4A; EDSVASC; PMGEDSV; Tsk2; Tsk-2
Chromosome: 1
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 guide RNA sequences (AGTGGTGCTCCTGGCAAGGA and ACAGCAATAGCTCTCACCGG) are targeted to exon 39 to introduce a glycine to aspartic acid substitution in amino acid 938 (G938D; nucleotide change GGT to GAT) at the end of the triple helical collagenous domain. This mutation is analogous to one found in Vascular Ehlers-Danlos syndrome (vEDS) patients.