B6.Cg-Washc4^em1Ssod/J

Stock number: 036929
Product name: SWIP^P1019R
Research areas: Immunology, Inflammation and Autoimmunity Research, Mouse/Human Gene Homologs, Neurobiology Research

Description

SWIP^P1019R knock-in mice express the P1019R (proline to arginine) amino acid substitution in the Washc4 (WASH complex subunit 4) locus. The mutation is orthologous to the patient mutation WASHC4^c.3056c>g. Mice homozygous for the mutation exhibit progressive motor deficits and cognitive impairment. These mice be useful in studies of Wiskott-Aldrich syndrome.

Detailed description

Washc4 (WASH complex subunit 4) encodes one of the five components in the WASH (Wiskott-Aldrich syndrome protein and SCAR homology) complex. WASH is involved in endosomal trafficking. The human WASHC4^c.3056C>G mutation (orthologous to mouse P1019R) is associated with human intellectual disability and impaired motor function.

 SWIP^P1019R knock-in mice were created using CRISPR/cas9 genome editing to express the P1019R (proline to arginine) amino acid substitution in exon 29 of the Washc4 locus. The mutation is in a region critical to binding the WASH complex. Quantitative spatial proteomic analysis in the brain indicates that the substitution destabilizes the WASH complex and disrupts both endosomal and lysosomal pathways. Mice homozygous for the mutation are viable and fertile, however, fertility in females declines after 6 months of age. Homozygous mice exhibit increased apoptosis in the motor cortex (10 month old mice), lipofuscin accumulation in cell bodies of primary motor cortex neuron (7 month old mice), deficits in cued fear memory, poor performance on the rotating rod, and progressive motor function decline (slowness, longer strides, altered gait symmetry beginning at 5.5 to 6.5 months of age). These mice be useful in studies of Wiskott-Aldrich syndrome.

Development

CRISPR/cas9 endonuclease-mediated genome editing was used to create a CCT to CGT (P1019R, proline to arginine) point mutation in exon 29 of the Washc4 locus on chromosome 10. The mutation is in a region critical to binding the WASH complex. Single guide RNA and cas9 endonuclease were introduced into B6SJLF1/J-derived fertilized eggs by pronuclear injection. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. Mice were further backcrossed for six generations onto the C57BL/6J background by the donating laboratory (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

In 2022, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. One of the 43 markers throughout the genome was segregating on Chromosome 1 with SJL. Also, one of the 5 markers that determine C57BL/6J from C57BL/6N, the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus, was found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Washc4^em1Ssod
Name: endonuclease-mediated mutation 1, Scott H Soderling
MGI accession ID: MGI:6783463
Generation method: Endonuclease-mediated
Attributes: Not Specified
Synonyms: SWIP^P1019R
Marker symbol: Washc4
Marker name: WASH complex subunit 4
Marker synonyms: A230046K03Rik; KIAA1033; mKIAA1033; MRT43; RGD1309995; SWIP
Chromosome: 10
Strain of origin: (C57BL/6J x SJL/J)F1
Molecular note: Proline codon 1019 (CCT) in exon 29 was targeted for change to an arginine codon (CGT)(p.P1019R) with an sgRNA (targeting TTGAGAATACTCACAAGAGGAGG) and an ssODN template (ATTTCGAAGGCCAAAGAATATACATCTCCGAAATTTCTATATCATTGTTCGTCCTCTTGTGAGTATTCTCAAAACTAGAAGTGAGTTATTGATGGGTGTTAATACAGATTCAGTTTCCATAAAGCA) using CRISPR/Cas9 technology. The mutation mimics a mutation found in some human Wiskott–Aldrich syndrome patients.