C57BL/6-Rnf111^em1Litt/J

Stock number: 036868
Product name: Arkadia^fl
Research areas: Research Tools

Description

Exon 13 of the mouse Rnf111 (ring finger 111; also called Arkadia) gene is flanked by loxP sites in these Arkadia^fl mice. Cre recombinase-mediated excision of the floxed region removes the enzyme activity domain. This strain been useful in studies of Th17 and Treg cell differentiation.

Detailed description

Rnf111 (ring finger 111; also called Arkadia) is an E3 ubiquitin ligase that mediates TGF-Β signaling during development.

Exon 13 of the mouse Rnf111 gene is flanked by loxP sites in these Arkadia^fl mice. Cre recombinase-mediated excision of the floxed region removes the enzyme activity domain.

Inactivation of Rnf111 in CD4⁺ T cells (achieved through crosses with Cd4-cre mice, Stock No. 022071) results in impaired Treg cell differentiation in vitro, loss of RORγt⁺FOXP3⁺ iTreg cells in the intestinal lamina propria, and increasing susceptibility to microbiota-induced mucosal inflammation. Experiments suggest that no Arkadia enzyme activity is detected in knock-out cells.

Development

Exon 13 of the mouse Rnf111 (Arkadia) gene was flanked by loxP sites using CRISPR/Cas9 methodologies (sgRNAs GCATCTTTCAATTGTTCCCT and GTTAATAAGGGCGTGACCACG). The mutation was created in C57BL/6J embryos. Resultant mice were backcrossed to C57BL/6J for 2 generations by the donating laboratory (see SNP note below).

Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our living colony, an aliquot of the frozen sperm was used to fertilize oocytes from C57BL/6J inbred females (Stock No. 000664).

In 2022, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Two of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, including the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Rnf111^em1Litt
Name: endonuclease-mediated mutation 1, Dan R Littman
MGI accession ID: MGI:6818629
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Arkadia^fl
Marker symbol: Rnf111
Marker name: ring finger 111
Marker synonyms: ARK; Arkadia; hRNF111
Chromosome: 9
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing is used to insert loxP sites on either side of exon 13.