C57BL/6J-Atl1^em3Lutzy/Mmjax

Stock number: 036807
Product name: Atl1^em3Lutzy (exon 13 del)
Research areas: Cell Biology Research, Neurobiology Research

Description

At11^em3Lutzy mice have endogenous exon 13 deleted in the atlastin GTPase 1 (Atl1) gene. This strain may be useful for studying the role of ATL1 in the formation of the tubular endoplasmic reticulum (ER) network and in axon elongation in neurons.

Detailed description

Atl1^em3Lutzy mice have endogenous exon 13 deleted in the atlastin GTPase 1 (Atl1) gene.

ATL1 is a GTPase and Golgi body transmembrane protein which plays a role in formation of the tubular endoplasmic reticulum network and in axon elongation in neurons. Atl1 mutations are implicated in Hereditary spastic paraplegia (HSP) and Hereditary Sensory Neuropathy type 1D (HSN1D).

Heterozygous and homozygous Atl1^em3Lutzy mice are viable and fertile with no overt phenotype. The donating laboratory indicates that homozygous mice are born at expected Mendelian ratios from heterozygous intercrosses (~29.5%).

If additional characterization of these mice is performed, we may modify the strain description accordingly.

Development

The Atl1^em3Lutzy allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing and was a byproduct when trying to create the Atl1^WT allele (RRID:MMRRC 072114-JAX). Guide RNAs (CTGGCTGCAGTGTCTCGAGG, CACCAAGCCAGTGCTAGTCA) were selected to excise murine exon 13 of the atlastin GTPase 1 (Atl1) gene on chromosome 12, without replacement. Mouse Atl1-201 transcript (ENSMUST00000021466.10) was used as reference for the exon number and guide sequences. Guide RNA, cas9, and the double stranded plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.

Allele

Symbol: Atl1^em3Lutzy
Name: endonuclease-mediated mutation 3, Cathy Lutz
MGI accession ID: MGI:7787103
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Atl1
Marker name: atlastin GTPase 1
Marker synonyms: AD-FSP; ATL-1; atlastin1; FSP1; HSN1D; SPG3; Spg3a
Chromosome: 12
Strain of origin: C57BL/6J
Molecular note: Using CRISPR/Cas9 endonuclease-mediated genome editing, a byproduct when trying to create the Atl1(WT) allele, murine exon 13 of the atlastin GTPase 1 (Atl1) gene was excised without replacement.