C57BL/6J-Slc6a1^em1Lutzy/Mmjax

Stock number: 036755
Product name: B6J.LSL_Slc6a1
Research areas: Developmental Biology Research, Neurobiology Research, Research Tools

Description

Slc6a1^em1Lutzy is a CRISPR/cas9 generated mutant of the Slc6a1 (solute carrier family 6 (neurotransmitter transporter, GABA), member 1) gene carrying a loxP-flanked STOP (LSL) in intron 6. The LSL prevents expression of Slc6a1, creating a reversible null allele. These mice may be useful in studies of molecular mechanisms of GABA inhibitory neurotransmission.

Detailed description

Slc6a1 (solute carrier family 6 (neurotransmitter transporter, GABA), member 1) encodes a gamma-aminobutyric acid (GABA) transporter GAT1, which removes GABA from the synaptic cleft. Genetic disruption of SLC6A1 in humans is associated with several neurodevelopmental disorders including childhood-onset epilepsy, developmental delays, movement disorders and features of autism spectrum disorder.

Slc6a1^em1Lutzy knockin/knockout mice carry a loxP-flanked STOP (LSL) cassette upstream of exon 7 of the Slc6a1 gene. The LSL cassette prevents expression of GABA transporter GAT1 until the cassette is removed by cre-mediated recombination of the loxP sites, thus restoring expression of GAT1. Prior to recombination, homozygous mice are viable, born at Mendelian ratios, but are frequently non-productive in breeding. Some homozygous mice exhibit small size and ataxia. mRNA expression of homozygous brain tissue by qRTPCR was unable to detect expression of Slc6a1 in LSL mice, with reduced expression in heterozygous mice.

When LSL males are bred with Sox2-Cre female mice (B6.Cg-Edil3^{Tg(Sox2-cre)1Amc}/J, Stock No. 008454), which express cre in epiblast cells at embryonic day 6.5, the resulting mice are born at Mendelian ratios and appear healthy. mRNA expression of homozygous brain tissue by qRTPCR showed restored expression of Slc6a1 in recombined mice, with reduced expression in heterozygous mice.

Development

The Slc6a1^em1Lutzy allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs were selected to insert an LSL targeting vector with a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of exon 7 of the Slc6a1 (solute carrier family 6 (neurotransmitter transporter, GABA), member 1) gene. Slc6a1 transcript Slc6a1-201 (ENSMUST00000032454.8) was used as reference for the exon number and guide sequences. The guides (GGTGGTCAGTGGTACTTAGT and GTGGTCAGTGGTACTTAGTG) and double-stranded plasmid donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo-pregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J (Stock No. 000664) mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.

Allele

Symbol: Slc6a1^em1Lutzy
Name: endonuclease-mediated mutation 1, Cathy LUtz
MGI accession ID: MGI:7518260
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Null/Knockout
Marker symbol: Slc6a1
Marker name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Marker synonyms: GABATHG; GABATR; Gabt; Gabt1; GAT1; GAT-1; hGAT-1; MAE; XT-1; Xtrp1
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing used guide RNAs guides (GGTGGTCAGTGGTACTTAGT and GTGGTCAGTGGTACTTAGTG) to insert an LSL targeting vector with a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of exon 7 of the gene. Slc6a1 transcript Slc6a1-201 (ENSMUST00000032454.8) was used as reference for the exon number and guide sequences.