C57BL/6-Del(3Sprr2a1-Sprr2a3)1Lvh/J

Stock number: 036663
Product name: Sprr2a-deficient, Sprr2a^-
Research areas: Immunology, Inflammation and Autoimmunity Research, Research Tools

Description

Sprr2a-deficient (Sprr2a^-) mice carry a CRISPR/Cas9-generated deletion of all 3 genes encoding the same Sprr2a protein: Sprr2a1, Sprr2a2, and Sprr2a3. Absence of the antimicrobial protein (AMP) in homozygotes leads to the expansion of Gram-positive bacteria in the small intestine and increased susceptibility to infection by Listeria monocytogenes, a Gram-positive pathogen. Helminth infection elicits the production of type 2 cytokines, such as IL-4 and IL-13, with mice demonstrating increased enteric bacterial invasion.

Detailed description

SPRR2A (encoding small proline rich protein 2A), expressed in goblet cells and Paneth cells in the mouse intestine, contributes to intestinal innate immunity by shaping the composition of the gut microbiota and by limiting pathogenic infection by Gram-positive bacteria. As an intestinal antimicrobial protein (AMP), it is highly up-regulated in the mouse small intestine after colonization with commensal bacteria and helminths.

These Sprr2a-deficient (Sprr2a^-) mice carry a CRISPR/Cas9-generated deletion of an ~81 kb genomic segment on mouse Chromosome 3 carrying all 3 Sprr2a genes: Sprr2a1, Sprr2a2, and Sprr2a3. These genes all encode the same protein.

Absence of SPRR2A in homozygotes leads to the expansion of Gram-positive bacteria in the small intestine and increased susceptibility to infection by Listeria monocytogenes, a Gram-positive pathogen. Helminth infection elicits the production of type 2 cytokines, such as IL-4 and IL-13, with mice demonstrating increased enteric bacterial invasion. SPRR2A has also been demonstrated to be necessary to prevent intestinal bacteria from invading the intestinal barrier during Heligmosomoides polygyrus (H. bakeri) infection.

Development

An ~81 kb genomic segment encoding Sprr2a1, Sprr2a2, and Sprr2a3 on mouse Chromosome 3 was deleted using CRISPR/Cas9 methodologies (gRNAs: GTGTAGAAAAAAGGATCGGTGGG (upstream), and ATTATCAGCGGTGTACTGCCAGG (downstream); GRCm38.p6: 92,210,732-92,291,813). The mutation was created in C57BL/6J embryos. Resultant mice were backcrossed to C57BL/6J for 5 generations by the donating laboratory.

In 2021, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Two of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, including the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Del(3Sprr2a1-Sprr2a3)1Lvh
Name: deletion, chr 3, Lora Hooper
MGI accession ID: MGI:6729717
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Sprr2a^-
Marker symbol: Del(3Sprr2a1-Sprr2a3)1Lvh
Marker name: deletion, chr 3, Lora Hooper
Chromosome: 3
Strain of origin: C57BL/6J
Molecular note: An 81 kb genomic segment encoding Sprr2a1, Sprr2a2, and Sprr2a3 is deleted using CRISPR/Cas9 methodologies (gRNAs: GTGTAGAAAAAAGGATCGGTGGG (upstream), and ATTATCAGCGGTGTACTGCCAGG (downstream); GRCm38.p6: 92,210,732-92,291,813).