BALB/c-Sting1^em3Vnce/J

Stock number: 036638
Product name: Sting KO
Research areas: Immunology, Inflammation and Autoimmunity Research

Description

Sting KO mice carry a knock-out allele having a 5 bp deletion in exon 3 of the mouse Sting1 (stimulator of interferon response cGAMP interactor 1) gene. Though mutated mRNA is expressed in cell types that normally express Sting1, immunoblot of bone marrow macrophages demonstrates that no protein is produced.

Detailed description

Sting KO mice carry a knock-out allele having a 5 bp deletion in exon 3 of the mouse Sting1 (stimulator of interferon response cGAMP interactor 1) gene. Though mutated mRNA is expressed in cell types that normally express Sting1, immunoblot of bone marrow macrophages demonstrates that no protein is produced. The homozygous mutant mice fail to produce type I IFN in response to cyclic dinucleotides. They are also defective for immune control of certain syngeneic transplanted tumor cell lines (e.g., 4T1).

Development

A 5 bp deletion (GCCTC; nucleotides 402-406 of NM_001289591.1) was introduced to exon 3 of the mouse Sting1 gene via CRISPR/Cas9 methodologies (sgRNA sequence: GTCCAAGTTCGTGCGAGGCTAGG, PAM is underlined). The mutation was created in BALB/cAnNCrl embryos and backcrossed to the same for two generations by the donating laboratory. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize BALB/cJ oocytes (Stock No. 000651).

in 2022, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the rederived living colony at The Jackson Laboratory Repository. One of the 43 markers throughout the genome was segregating for BALB/cJ substrain.

Allele

Symbol: Sting1^em3Vnce
Name: endonuclease-mediated mutation 3, Russell E Vance
MGI accession ID: MGI:6729712
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Sting1
Marker name: stimulator of interferon response cGAMP interactor 1
Marker synonyms: 2610307O08Rik; ERIS; hMITA; hSTING; MITA; MPYS; NET23; RGD1562552; rSTING; SAVI; Sting; STING-beta; Tmem173
Chromosome: 18
Strain of origin: BALB/cAnNCrl
Molecular note: CRISPR/cas9 genome editing is used to create a 5 bp deletion (GCCTC; nucleotides 402-406) in exon 3. Immunoblot analysis of bone marrow macrophages demonstrates that no protein is produced.